Regulation of Carbon Utilization
Chapter
85
MILTON H. SAIER, JR., TOM M. RAMSEIER, and JONATHAN REIZER
For nearly a century it has been recognized that the presence of a rapidly metabolizable carbon source in the growth medium of a microorganism can inhibit the synthesis of enzymes involved in the metabolism of other carbon-containing compounds (for a review of the early literature, see reference 92). The phenomenon was intensively studied during the first half of the 20th century, primarily from a physiological standpoint, but these studies did not lead to mechanistic insight. As glucose was often the most effective carbohydrate causing repression of the synthesis of target catabolic enzymes, the phenomenon became known as the glucose effect. Early analyses of the glucose effect led to the postulate that it occurs whenever growth conditions are such that degradation (catabolism) exceeds biosynthesis (anabolism). This postulate in turn led to a second notion, namely, that it was the accumulation of one or more cytoplasmic catabolites, derived from the repressing carbohydrate, that gave rise to the glucose effect. This concept, now known to be in error in some instances but not in others, caused the term "catabolite repression" to be coined.
The glucose effect in Escherichia coli and other bacteria consists of at least four kinetically and mechanistically distinguishable, but physiologically related, phenomena termed permanent repression, transient repression, inducer exclusion, and inducer expulsion (92, 108, 122, 126). Permanent repression and transient repression refer to long- and short-lived forms of repression that occur in response to glucose addition to the growth medium of a microorganism. Both of these phenomena are independent of cytoplasmic inducer concentration. Inducer exclusion and inducer expulsion, on the other hand, refer to the inhibition of inducer uptake into the cell and stimulation of inducer release from the cytoplasm, respectively. Bacterial physiologists frequently lump all four of these phenomena together under the general heading of catabolite repression because they all cause repression of target enzyme synthesis in response to the presence of a potential carbon and energy source in the growth medium. Many proteins in addition to carbon catabolic enzymes, including those involved in bioluminescence, photosynthesis, sporulation, antibiotic biosynthesis, pigment biosynthesis, and extracellular macromolecular degradation, have been shown to be subject to catabolite repression (for a review, see reference 133).
In 1965, Makman and Sutherland identified cyclic AMP (cAMP) in E. coli and showed that its cytoplasmic concentration varied inversely with growth rate when the carbon source was varied (94). The subsequent identification of the cAMP receptor protein (CRP) and description of the phenotypic properties of mutants lacking either the cAMP biosynthetic enzyme, adenylate cyclase (cya mutants), or CRP (crp mutants) led to general acceptance of the notion that cAMP, acting together with CRP, provided the principal means of effecting catabolite repression (Fig. 1) (for comprehensive reviews, see references 18, 77, and 108). Thus, cya and crp mutants could not utilize most of the carbon sources (lactose, maltose, glycerol, etc.) that were utilized as growth substrates by the wild-type strain because synthesis of the catabolic enzymes responsible for the metabolism of these compounds could not be induced. All of the genes that could not be expressed in the mutants were genes known to be subject to catabolic repression. These observations suggested correctly that their expression was regulated by the intracellular concentration of cAMP, and cAMP was acting via CRP. However, they did not exclude the possibility that other regulators could also give rise to the repressive effects. The fact that cAMP and CRP were essential for the expression of many catabolite repressible genes made it difficult to assess the potential roles of other regulatory elements.
Further studies (for reviews, see references 115 and 134) led to recognition of the fact that the phosphoenolpyruvate (PEP)-dependent sugar phosphotransferase system (PTS) in enteric bacteria could coordinately modulate both cytoplasmic inducer and cAMP levels in a physiologically meaningful manner that could account for the phenomena of inducer exclusion and catabolite repression. A regulatory mechanism was proposed (143) and supported by extensive experimentation (see below), and this model became generally accepted as the mechanism of catabolite repression in bacteria (Fig. 2). Consequently, many molecular biologists shifted their efforts to other topics, and a trend was initiated whereby prokaryotes were largely abandoned as model systems while efforts to develop eukaryotes as experimental systems were intensified. A general atmosphere came to prevail in which many scientists believed either that bacterial systems had been exhausted of information or that they were not relevant to corresponding processes in eukaryotes.
Meanwhile, evidence suggesting that our perception of catabolite repression in bacteria, based solely on a cAMP-dependent mechanism, was incomplete slowly accumulated. cAMP-independent catabolite repression in E. coli was clearly demonstrated (37; see reference 164 for a comprehensive review). Moreover, Bacillus subtilis was shown to possess nearly nonexistent levels of cAMP that did not vary in a fashion that could account for repressive phenomena observed in this organism (91). Nevertheless, the trend had been set; interest in catabolite repression was minimal, and progress in the elucidation of the cAMP-independent repressive mechanisms was exceptionally slow. Despite the development of the new technology in molecular genetics, it took over a decade before distinct mechanisms accounting for the unexplained repressive phenomena began to be elucidated. It is now possible to delineate the various mechanisms that apparently account for cAMP-independent catabolite repression, although our views are still based on fragmentary information.
Several distinct cAMP-independent mechanisms appear to play a role in regulating the rates of synthesis of specific proteins in response to carbon source availability in eubacteria, and some of these mechanisms are operative in simple eukaryotic microorganisms. Each of these mechanisms may apply to more than one of the four physiologically related subcategories of catabolite repression mentioned above, and three evolutionarily distinct protein phosphorylation systems are involved (for reviews, see references 135 to 140 and 148). The different regulatory mechanisms apply to a variety of target proteins in enteric and gram-positive bacteria. The mechanisms applicable to E. coli and Salmonella typhimurium (official designation, Salmonella enterica serovar Typhimurium), most of which are only partially defined, are listed in Table 1 and include the following: (i) PTS-mediated control of the generation of cytoplasmic inducer by a mechanism involving the phosphorylatable PTS protein IIAGlc (Fig. 2), a protein that allosterically controls the activities of target permeases and catabolic enzymes; (ii) fructose repressor (FruR)-mediated control of central pathways of carbon metabolism (see reference 136 for a brief review); (iii) synthesis of catabolite repressible proteins in response to the availability of alternative RNA polymerase sigma factors which are synthesized only under starvation conditions; and (iv) sensor kinase-response regulator control of gene expression (this may include the sensor kinase-response regulator [CreC-CreB]-mediated regulation of unidentified target systems in E. coli).
Table 1Mechanisms of carbon catabolite repression in bacteria |
In this review, we focus on the physiology, biochemistry, and molecular biology of catabolite repression-related phenomena in enteric bacteria. Recent experimentation with E. coli suggests that this term applies to nitrogen as well as carbon metabolic enzymes and that phosphorus metabolism, like nitrogen metabolism, is indirectly linked to carbon metabolism. Comparative data relevant to analogous processes in gram-positive bacteria will be briefly summarized in the concluding section. In some cases, topics will be discussed only briefly if other recent reviews have provided detailed coverage of the subject. Some of the ramifications of carbon metabolic control which together lead to a comprehensive view of the various control systems to be discussed here can be found in other chapters of this book (see chapters 10, 17, 74, 75, 76, 83, 92, 94, 95, and 96).
The best-characterized mechanism of catabolite repression in enteric bacteria involves the cytoplasmic sensor of carbon and energy sufficiency, cAMP, and the dimeric CRP, which interacts initially with specific sequences in cAMP-CRP-responsive promoters, induces bends in the DNA, and interacts with RNA polymerase to promote transcriptional initiation (18, 50, 77, 93, 108, 127, 159). Exogenous glucose both inhibits the synthesis of cAMP in intact E. coli cells and stimulates the efflux of cAMP from the cell cytoplasm (94). Efflux of cAMP, catalyzed by the cyclic nucleotide transport system, is driven by the membrane potential which is generated under conditions of energy availability (144). Synthesis of cAMP, catalyzed by adenylate cyclase, is regulated by a protein phosphorylation mechanism that is catalyzed by the PTS (59, 143). Other mechanisms of adenylate cyclase regulation in enteric bacteria are undoubtedly operative.
The PTS also regulates the uptake, or the cytoplasmic generation, of inducers of non-PTS catabolic operons (inducer exclusion) in processes that are coordinate with inhibition of adenylate cyclase (143). The mechanism involves a central regulatory protein of the PTS, the glucose-specific enzyme IIA (IIAGlc) (137, 138, 145), previously termed enzyme IIIGlc. This protein is the product of the crr gene (Fig. 2) (for reviews, see references 115, 134, and 138). In this mechanism of carbon catabolite repression, the PTS enzyme II complexes sense the availability of extracellular sugar substrates of the PTS, and since intracellular catabolites are not detected, the term "catabolite repression" is technically incorrect.
PTS permeases function as transmembrane signaling devices in one of the first complex sensory transduction mechanisms to be elucidated in detail. When one of the PTS sugars is present in the bacterial growth medium, the IIAGlc protein becomes dephosphorylated as the phosphoryl groups are transferred to incoming sugar molecules via the sugar-specific permease proteins. This process is believed to result in both allosteric deactivation of adenylate cyclase (which seems to be positively regulated by phosphorylated IIAGlc) and allosteric inhibition of the non-PTS permeases and catabolic enzymes that generate cytoplasmic inducers (which are negatively controlled by free IIAGlc) (Fig. 2) (134, 138).
Since earlier experiments had essentially established the validity of the main mechanistic features of the process whereby IIAGlc regulates the activities of target permeases and catabolic enzymes (Fig. 2), recent efforts have been devoted primarily to elucidation of the three-dimensional structures of the regulatory proteins and identification of the sites of the protein-protein regulatory interactions (20, 21, 35, 44, 45, 46, 85, 111, 158, 173, 174). The concerted mechanism of catabolite repression, involving PTS-mediated protein phosphorylation and the control of both cAMP synthesis and cytoplasmic inducer generation, is the only such mechanism that is well understood at the molecular level (108, 134, 164).
Exactly how the IIAGlc protein interacts with HPr and certain targets of allosteric regulation has recently been elucidated. Mutations in the lactose, maltose, and melibiose permeases as well as glycerol kinase that specifically abolish regulation by IIAGlc, presumably by destroying the complementarity of the allosteric binding sites on these permeases, have been isolated and, in some cases, characterized in molecular detail (147; see reference 138 for primary references). The IIAGlc-binding site in LacY is almost certainly within the central cytoplasmic loop of the permease between transmembrane spanners 6 and 7. The same is probably true of the raffinose permease of E. coli (161). The IIAGlc-binding site within the maltose permease is localized to the cytoplasmic ATP hydrolyzing subunit of this permease, MalK. That on the melibiose permease may be localized to the C-terminal tail of this protein (see reference 138 for primary references).
Examination of the sequences of the MalK, LacY, and RafB permeases led to the identification of a consensus sequence for IIAGlc binding (161). Arabinose isomerase of E. coli was shown to contain this consensus sequence and was later shown to be regulated by IIAGlc in vitro (C. Hoischen, J. Reizer, and M. H. Saier, Jr., unpublished results). This sequence is, however, lacking in glycerol kinase, the melibiose permease, and adenylate cyclase, proteins that are also allosterically regulated by IIAGlc. In these latter cases, IIAGlc presumably binds to a different set of amino acyl residues or to the same residues occurring in different sequence.
Three-dimensional analyses of IIAGlc reveal that this protein consists of a β-barrel with Greek key and jelly roll topological features (85). HPr, which interacts with IIAGlc, has the structure of a skewed open-faced sandwich with three α-helices overlying a four-stranded antiparallel β-sheet (64). Nuclear magnetic resonance analyses of the complex of these two proteins reveal that HPr binds to a site on the surface of IIAGlc that overlaps the active-site crevice located on one side of the β-barrel (20, 21). Mutagenic analyses suggest that the lactose permease binds to the same face of IIAGlc (184).
Elegant X-ray diffraction analyses have led to the conclusion that the tetrameric glycerol kinase binds four molecules of IIAGlc in an allosteric regulatory complex that is presumably relevant to the in vivo complex (69). The crystal structure of this complex at 2.6-Å (0.26-nm) resolution revealed that IIAGlc binds to glycerol kinase at a site distant from the catalytic site of the latter enzyme. This fact suggests that long-range conformational changes mediate the inhibition of glycerol kinase by IIAGlc. The two proteins interact largely by employing hydrophobic and electrostatic attractive forces. Only one hydrogen bond involving an uncharged group appears to play a role. The phosphorylation site of IIAGlc (His-90 in the E. coli IIAGlc) proved to be buried in a hydrophobic environment formed by the active-site region of IIAGlc and a 310 helix of glycerol kinase. This fact suggests that phosphorylation prevents IIAGlc binding by directly disrupting protein-protein interactions. The elucidation of the structure of this protein complex established beyond a shadow of a doubt that IIAGlc is both necessary and sufficient to effect the allosteric regulation of its various target systems, the permeases and catabolic enzymes that are inhibited by the nonphosphorylated form of this protein. The detailed mechanism by which adenylate cyclase is allosterically activated by the histidyl-phosphorylated form of IIAGlc (see next section) has yet to be determined and may involve additional proteins.
Mutants of enteric bacteria that lack any one constituent of the pts operon, enzyme I, HPr, or IIAGlc, normally exhibit very low rates of cAMP synthesis (49, 58, 112, 143). These in vivo observations are attributed to a mechanism of adenylate cyclase regulation that involves direct binding of phosphohistidyl IIAGlc [IIAGlc(his-P)] to the C-terminal domain of the adenylate cyclase protein. IIAGlc may thereby relieve the inhibitory effect of this C-terminal domain on the N-terminal catalytic domain of adenylate cyclase. The net result of IIAGlc(his-P) binding is apparently activation of the autoregulated, i.e., internally inhibited, enzyme to an extent in excess of 10-fold (27, 143). The organization of adenylate cyclase in enteric bacteria evidently differs from that in yeast cells, in which the N-terminal domain is believed to regulate the C-terminal catalytic domain (see reference 113 for sequence comparisons of adenylate cyclases).
Evidence for the model enunciated above is extensive even though in vitro regulation of adenylate cyclase by IIAGlc, reflective of the in vivo regulatory interactions, has never been demonstrated (see references 115 and 134). The large increase in cAMP synthetic rates in crp mutants lacking CRP (128) does not occur if the crr gene encodes a nonfunctional IIAGlc protein (26, 36). Similarly, a pts mutant lacking enzyme I or HPr does not show this increase. It has been proposed that CRP or an effector protein under positive cAMP-CRP transcriptional control interferes with the activation process by preventing the activation elicited by the binding of IIAGlc(his-P) to adenylate cyclase. It is also possible that IIAGlc(his-P), together with a protein that is subject to negative control by the cAMP-CRP complex, forms a ternary complex with adenylate cyclase that is essential for the PTS-mediated activation of these enzymes. Some evidence suggests that the fructose repressor and the diphosphoryl transfer protein of the fructose operon (DTP or FruB) may play a role in adenylate cyclase regulation (48, 54; M. Crasnier and M. H. Saier, Jr., unpublished results). The involvement of proteins in addition to adenylate cyclase and IIAGlc in the regulation of cAMP production remains an intriguing possibility.
Mutations in the structural gene for adenylate cyclase, cya, that alter IIAGlc(his-P)-mediated activation of this enzyme have been isolated (26, 27). One such mutant contains a single point mutation, D-414→N, in a region of the protein that had been shown by gene truncation experiments not to be essential for adenylate cyclase catalytic function. Because this base substitution mutation gave rise to a defective enzyme that produced cAMP at low rates in vivo, it was proposed that D-414 is involved in IIAGlc(his-P)-mediated activation of adenylate cyclase (27).
Starting with the D-414→N mutant cya gene, spontaneous mutations giving rise to large increases in cAMP production in the absence of functional IIAGlc were isolated and characterized (26, 27). These secondary mutations were, without exception, C-terminal deletion mutations located in the cya gene around the D-414→N mutation. One mutation generated a 48-kDa protein, half the size of wild-type adenylate cyclase. It was shown to produce 10 times more cAMP than an isogenic strain bearing a wild-type cya gene and a mutant crr gene. The former strain exhibited adenylate cyclase activity that was not regulated by the presence of glucose in the growth medium. The phenomenon of diauxic growth (92), as examined with glucose and maltose as the two carbon sources, was abolished. These results support the notion that the C-terminal domain negatively regulates the N-terminal catalytic domain of adenylate cyclase and implicate the C-terminal domain of adenylate cyclase in IIAGlc-mediated regulation. They further suggest that IIAGlc-dependent regulation of adenylate cyclase is in large measure responsible for the phenomenon of diauxie. The details of the mechanism responsible for adenylate cyclase regulation by IIAGlc and other physiologically relevant effectors have yet to be determined.
The phenomenon of transient repression (92) still goes without mechanistic explanation. Non-metabolizable lactose analogs such as thiomethyl-β-galactoside promote transient repression (163), but they should diminish the proton motive force in the presence of a functional lactose permease. Since cAMP efflux is maximal in the presence of a large proton motive force (144), it seems unlikely that transient repression induced by a nonmetabolizable sugar analog such as thiomethyl-β-galactoside is due to alterations in the cAMP efflux rate. It is known that the intensity and duration of transient repression is influenced by the levels of PTS enzymes (49, 143). Decreasing the level of E. coli enzyme I by mutation enhanced the sensitivity of lac operon expression to transient repression by both glucose and the nonmetabolizable glucose analog methyl α-glucoside when cells were growing continuously on pyruvate (84). Moreover, loss of the IIAGlc protein abolished transient repression altogether. Since these experiments were conducted in a cAMP phosphodiesterase-negative genetic background (84), it is clear that these effects had nothing to do with cAMP degradation. As IIAGlc(his-P) is believed to be an activator of adenylate cyclase (49, 143), it is most reasonable to postulate that this cyclic nucleotide biosynthetic enzyme mediates transient repression. The detailed mechanism has yet to be elucidated.
Transcriptional regulation of the cya gene encoding adenylate cyclase has been studied by using operon and protein cya-lacZ gene fusions in both E. coli and S. typhimurium genetic backgrounds (4; see reference 18 for a recent review). In both organisms, approximately two- to fourfold variations in cya promoter activity were reported with the cAMP-CRP complex repressing cya transcription. Thus, in cells actively growing under glucose-repressing conditions, cya gene expression is maximal. This effect is in the opposite direction of, and clearly does not account for, the approximately 100-fold decrease observed in adenylate cyclase activity in response to glucose as reported originally by Makman and Sutherland (94). crp mutants exhibit maximal activity that is insensitive to fluctuations in response to carbon sources. Increased cya gene expression in crp mutants is in the correct direction but is of insufficient magnitude to account for the increased adenylate cyclase activity observed in crp mutants. In these mutants, glucose-specific enzymes II are not induced, and the mutants consequently are insensitive to glucose repression (128). Increased cya gene expression in wild-type enteric bacteria under conditions of carbon excess (adenylate cyclase inhibition) presumably serves to prepare the bacteria in advance for adaptation. Thus, when the first carbon source becomes exhausted, the bacteria can produce increased amounts of cAMP and thereby rapidly adapt to the utilization of a new source of carbon.
The cya control region contains three promoters. The strongest, cyaP2, contains in its operator region a CRP-binding-site consensus sequence (6, 132), and DNase I footprinting studies indicated that the cAMP-CRP complex binds the cya operator, protecting the region between positions –20 and +11 (5, 7). All three promoters may be responsive to binding of the cAMP-CRP complex (75), since the cyaP2 promoter alone is insufficient for demonstration of a regulated response (131).
The initiator codon for the E. coli cya gene is an unusual UUG codon, which together with the weak ribosome-binding site gives rise to low-level translation. Reddy et al. (121) showed that translational efficiency could be increased about sixfold by replacing the UUG codon with an AUG codon. Sixfold elevation in the amount of adenylate cyclase proved lethal under the physiological conditions used (121).
From the considerations presented in this and the previous section, it appears that in wild-type enteric bacteria glucose exerts two opposing effects: first, inhibiting the activity of adenylate cyclase by a IIAGlc-mediated mechanism, and second, relieving the repression of cya gene expression by the cAMP-CRP complex. The former effect inhibits cAMP production and gives rise to cAMP-dependent repressive phenomena (diauxie, catabolite repression, and transient repression). Transcriptional activation of the cya gene by glucose, on the other hand, gives rise to an increase in the potential for cAMP production, once the glucose has been depleted from the medium. This latter response allows the bacteria to rapidly adapt to the changing availability of carbon sources, since high cAMP concentrations facilitate transcriptional activation of virtually all carbon catabolic operons concerned with the initiation of exogenous carbon utilization.
It has long been known that expression of the E. coli crp gene is regulated by the cAMP-CRP complex (25) as well as by antisense RNA (104). However, the physiological significance of these effects was not based in fact. Recently Hanamura and Aiba (56) have shown that the cAMP-CRP complex both inhibits and activates transcription of crp under specified conditions. The concentrations of cAMP that are required for positive autoregulation (activation) are apparently higher than those required for negative autoregulation (inhibition), both in vitro and in vivo. These observations suggest that in the presence of glucose (low cAMP), cellular CRP levels may go down while in the absence of glucose (high cAMP), cellular CRP levels go up. These responses parallel those of cAMP noted above, and they presumably serve to enhance the intensity of catabolite repression in the presence of glucose by depriving the cell of the CRP-mediated activation mechanism. Increased CRP levels under glucose starvation conditions enhance the potential of the cell to bring about CRP-mediated activation of a catabolic operon if another utilizable carbon source is present. It should be noted that because this increase in CRP concentration in response to glucose depletion requires both transcription and translation of the crp gene, it will be a slow process. The response of adenylate cyclase to glucose depletion mediated by IIAGlc of the PTS is expected to be a much more rapid adaptive response. The latter response is only slowly enhanced by reversal of glucose-promoted cAMP-CRP-mediated repression of the synthesis of the cya gene product that occurs upon depletion of glucose from the medium (see previous section).
In several studied examples, addition of excess cAMP does not fully overcome the repressive effect of glucose on carbon catabolic operons that are known to be under cAMP control (reviewed in references 18 and 164). One possible candidate for the mediator of this cAMP-insensitive repression is the CRP protein itself, for as noted above, cellular CRP levels vary in response to carbon source availability in a fashion that might partially explain carbon catabolite repression. In a recent publication, Ishizuka et al. (72) have rigorously addressed this question by using immunoblot and gel mobility shift assays to quantitate the amount of CRP in cells after growth under a variety of conditions. Their results showed that a reduction in the cytoplasmic CRP concentration caused by glucose addition partially accounted for catabolite repression. Further, when the cellular concentration of CRP was reduced by manipulation of crp gene expression rather than by addition of glucose, the rate of β-galactosidase synthesis decreased in proportion to the decrease in the CRP level. When cAMP was added to wild-type E. coli cultures growing on glucose, the transient repression of β-galactosidase synthesis was completely eliminated, but permanent repression was only partially reduced. This residual repression could be fully reversed by overexpression of the crp gene. These intriguing findings clearly suggest that cAMP-responsive operons are repressed in the presence of carbon sources such as glucose as a consequence of a reduction in both the cytoplasmic cAMP concentration (a rapid process, largely due to inhibition of adenylate cyclase) and the CRP concentration (a slow process, evidently due to autoregulation of crp gene transcription). While transient repression is apparently concerned with variations in cytoplasmic cAMP concentrations exclusively, permanent repression is a consequence of inhibited cAMP synthesis as well as repressed CRP synthesis. Stimulation of cAMP efflux under conditions of energy proficiency (144) could enhance the intensity of both.
Four factors appear to determine the efficacy of liganded CRP to activate transcription: (i) the degree of approximation to a CRP-binding sequence; (ii) the spacing of the two halves of the palindrome (6 bp versus 8 bp); (iii) the positioning of that sequence within the promoter relative to the –10 and –35 RNA polymerase-binding regions, and (iv) the occurrence of cooperative or antagonistic protein-protein interactions. A 22-bp palindromic consensus sequence, AAATGTGATCTAGATCACATTT (the most conserved bases are underlined), was recognized as a high-affinity site for liganded CRP, possessing affinity about 500-fold greater than for the lac operon CRP-binding site (15, 43). Regions distal to the CRP site are known to influence CRP binding (28, 86).
Barber et al. (13) have recently examined the relative strengths of CRP-binding sites and demonstrated that CRP binds to CRP-binding sites possessing 8-bp spacers (N8) with affinities that are equivalent to or somewhat lower than those for the more conventional 6-bp spacers (N6). The G+C content of the spacer played a role; a higher G+C content correlated with higher-affinity binding. Like N6 spacer sites, N8 spacer sites utilized both halves of the symmetrical protein recognition sequences, TGTGA and TCACA. Because of the increased number of nucleotides in the N8 spacer, the two recognition sequences in the DNA have an increased distance and a helical twist between them. These would be expected to cause displacement of the two recognition sequences with respect to the two symmetrically located α helices of the CRP dimer if there is no change in the DNA conformation.
To explain the proper alignment of the recognition elements in the DNA and in CRP, the authors proposed that the orientation of the two recognition elements in the DNA is restored to the original orientation as in the N6 spacer, and the physical distance in the DNA between the recognition sequences is decreased. The mechanism of such changes conceivably depends on the nature of the N8 sequence. A+T-rich N8 sequences may unwind in the center to realign the angular orientation of the two recognition sequences and bend into the minor groove facing the protein to reduce the distance, whereas G+C-rich N8 sequences may undergo a transition from B- to A-DNA, bringing about the required unwinding and compression.
Position within the promoter is also important for transcriptional activation. Gaston et al. (50) and Ushida and Aiba (166) have reported experiments, the results of which have been interpreted to provide a common general mechanism for CRP-dependent promoter activation. Both the melR and lac promoters were modified to provide a set of sequences having a CRP-binding site centered from 41.5 to 83.5 bp (melR) or 51.5 to 96.5 bp (lac) upstream from the start site of transcription. The promoter strength for all of the constructs was low in the absence of the cAMP-CRP complex. In both cases cAMP-CRP-dependent promoter derivative activity demonstrated periodicity. Constructs whose CRP-binding sites were located at near-integral turns of the helix (i.e., n × 10.5 bp) from the start site of transcription were activated by the cAMP-CRP complex. Constructs that introduced half-integral turns of the helix from the start site of transcription exhibited little, if any, cAMP-CRP-mediated stimulation of promoter activity. Therefore, CRP can activate transcription only when bound to DNA on the same face of the helix within a range of helical turns from the RNA polymerase-binding site. The data also showed that the extent of CRP-dependent promoter activation decreased with increasing CRP-binding-site distance from the start site of transcription.
The mode of action of CRP in transcriptional regulation has recently been reviewed (18, 77, 129) and compared with those of other positive control transcriptional regulators (3). Further, Kolb et al. (77) have summarized available three-dimensional structural analyses of the protein that suggest the conformational transitions that are induced by cAMP binding. Generally, when cytoplasmic cAMP concentrations are high, this cyclic nucleotide associates with CRP to form a liganded complex with a conformation different from that observed for the unliganded form. It can then bind to specific DNA sequences which normally occur near or within the promoters of operons included within the cAMP-CRP modulon. Binding of the liganded CRP complex to the DNA is accompanied by bending of the DNA strand as well as by the binding of other transcriptional catalytic and/or regulatory proteins such as RNA polymerase (16, 156). Consequently, activation of transcriptional initiation at the target promoter occurs.
In all documented cases, when the cAMP-CRP complex binds specifically to a promoter, it bends the DNA near the center of the dimeric CRP-binding site with a 90 to 130° angle. The actual angle observed is dependent on the base sequence of the binding site (see reference 18 for primary references). DNA bending undoubtedly facilitates proper protein-protein interactions in the transcriptional initiation complex and may also promote open-complex formation.
Among the protein-protein interactions that are well established for CRP are direct binding interactions with RNA polymerase. The presence of RNA polymerase at the promoter may be required for high-affinity CRP binding and vice versa, and under such conditions, these two proteins form a cooperative complex with the DNA. Direct binding of CRP to RNA polymerase (Kd = 1 to 3 μM) has been demonstrated in vitro in the absence of DNA (16, 114, 129, 156). Truncation of the C-terminal region of the α-subunit of RNA polymerase prevents CRP from activating transcription (70, 71), indicating that the truncated region may be involved in the interaction with CRP. These interactions apparently depend on both cAMP and σ 70.
As already noted with respect to the cya and crp operons, the cAMP-CRP complex can function as a positive or a negative effector, thereby promoting or preventing transcription in response to the availability or absence of a utilizable carbon source. Among the transcription factors with which CRP is known to interact are the AraC activator acting at the araBAD promoter (87), the MalT activator acting at the divergently transcribed malE and malK promoters (117, 130), and the CytR repressor acting at the deoP2 promoter (102). This last example is of particular note because the cAMP-CRP complex is absolutely required both for activation and for repression of transcriptional initiation.
Liganded CRP and CytR have been shown to bind cooperatively to the deoP2 promoter, forming a repression complex in which CytR is sandwiched between two DNA-bound cAMP-CRP complexes (153). cAMP-CRP enhances the binding of CytR more than 1,000-fold (110) via direct protein-protein interactions. The residues in CRP that interact with CytR in the repression complex may be different from those that interact with RNA polymerase in the activation complex, since single amino acid substitutions in two surface exposed loops of CRP abolish repression without blocking transcriptional activation (152).
Recently the structures of the CytR-cAMP-CRP repression complex and the polymerase-cAMP-CRP activation complex at the deoP2 promoter were probed at the DNA level by using both DNase I and uranyl footprinting. The two complexes showed similarities with respect to the protein-DNA phosphate contacts. CRP binds to two sites (sites 1 and 2), and CRP binding to site 2 does not interfere with polymerase binding. It was suggested that in the activation complex, the DNA is wrapped around a complex of the polymerase and one CRP molecule, while CytR competes with RNA polymerase for the binding of CRP (102). Binding of CRP at a single site thereby facilitates both the repression and the activation phenomena by promoting competitive CytR or RNA polymerase binding, depending on conditions.
The mechanisms by which the cAMP-CRP complex represses various operons are distinctive. For example, cya gene expression is repressed by binding the cAMP-CRP complex to the cya operator between positions –20 and +11, overlapping the RNA polymerase-binding site (6). By contrast, crp gene expression is repressed by an indirect mechanism. Liganded CRP binding to the crp promoter activates synthesis of an antisense RNA that originates from a divergent promoter, and this RNA inhibits crp transcription. It may promote formation of a transcriptional termination hairpin loop structure (103, 104).
As might be expected for a transcriptional activator that functions by binding to other proteins within the transcriptional activation complex, CRP function is influenced by the degree of superhelical coiling of the DNA as well as by prevalent DNA binding proteins such as HU. Superhelical density can influence the time required for open-complex formation and is undoubtedly of physiological significance. It is interesting in this connection that the addition of glucose to wild-type E. coli cells growing in acetate-containing medium at least transiently relaxes plasmid DNA (11). Plasmid relaxation was found to parallel the onset of transient repression of β-galactosidase synthesis. Assuming these observations to be relevant to catabolite repression, it is also of interest that glucose repression of β-galactosidase synthesis has been reported to be reversed by anaerobiosis (83). Anaerobiosis is known to enhance negative supercoiling (12).
Botsford and Harman (18) have tabulated a number of well-documented examples of genes under cAMP control. Almost all genes that encode enzymes and transport proteins that initiate the metabolism of an exogenous carbon source are under cAMP-CRP control, and expression of these genes is consequently subject to catabolite repression. The products of these genes convert the carbon nutrient to a common metabolic intermediate that can be further metabolized via one or more of the central pathways of carbon metabolism (i.e., glycolysis, the Krebs cycle, the Entner-Doudoroff pathway, the pentose phosphate pathway, the fatty acid oxidation pathway, etc.). However, sometimes sensitivity to cAMP-CRP is indirect rather than direct. A couple of well-documented examples will be cited.
The melibiose operon (melAB) encodes α-galactosidase and the melibiose permease, a sugar:cation symporter (124), and as expected, its expression is under cAMP control. However, the cAMP-CRP complex does not bind to the operator-promoter region of the melAB operon. Instead, the melR gene, which encodes a transcriptional activator of melAB, is subject to cAMP control (171).
Expression of the maltose (mal) regulon is similarly regulated. The malT gene, encoding an essential transcriptional activator of the mal regulon, is also subject to positive cAMP-CRP control (117). In this case, the malPQ operon, encoding maltodextrin phosphorylase and amylomaltase, is exclusively regulated by cAMP via the indirect action of this cyclic nucleotide on malT. The two divergently transcribed maltose permease operons, malEFG and malKLM, are subject to dual positive control by CRP, first as a result of cAMP-CRP controlled MalT production and second as a result of direct binding of liganded CRP to the promoter region.
Synthesis of some enzymes is subject to more than a single mechanism of catabolite repression. In the gluconeogenic pathway, two enzymes in E. coli respectively convert three- and four-carbon nonphosphorylated metabolites into PEP. The first of these two enzymes, PEP synthase, is not under cAMP control, but the second, PEP carboxykinase, is. Both of these enzymes are subject to regulation by a distinct positive transcriptional regulator, the FruR protein, and this second protein probably mediates a cAMP-independent form of catabolite repression (22, 23, 120; see below).
Flagellar synthesis in E. coli and S. typhimurium is subject to cAMP control, as is the synthesis of numerous chemoreceptors that detect carbon sources (128, 169). As the chemoreceptors direct flagellar motility of the bacteria via the chemotactic transmission system (90) so that the bacteria swim up concentration gradients of sugars, thereby facilitating carbon acquisition, this sensitivity to cAMP control is not surprising. Chemotaxis thus facilitates carbon acquisition. The fact that the primary chemoreceptors are frequently components of sugar transport systems (i.e., the enzyme II of the PTS specific for glucose, and the periplasmic maltose-binding receptor in enteric bacteria) renders this observation even more expected.
Since carbon metabolism is under cAMP control, growth, cell division, and entry into stationary-phase resting states would be expected to be influenced by this cyclic nucleotide. cya and crp mutants of E. coli grow and divide, but they do so more slowly than isogenic wild-type strains on all nutrient media tested. They also exhibit diminutive cell sizes and abnormal cell morphologies (33). A direct effect of cAMP on the activity of the DnaA protein which controls DNA replication initiation has been proposed (68), and the cya gene has been shown to exhibit discontinuous expression as a function of the cell cycle (167). It is possible that cAMP serves to coordinate DNA replication and cell division. In this connection, it is interesting that many but not all genes in E. coli that are specifically induced under starvation conditions are also under cAMP control (17, 97, 154, 155; see below).
Finally, genes involved in (i) pH regulation, (ii) intracellular glycogen metabolism, (iii) ubiquinone synthesis, (iv) thiosulfate reduction, (v) organic phosphate ester utilization, (vi) nitrogen (i.e., amino acid) utilization, (vii) iron uptake, (viii) drug (antibiotic) resistance, (ix) colicin induction and recognition, and (x) toxin production are all regulated directly or indirectly by cAMP-CRP (18). Many of these processes are related to carbon metabolism. For example, the need for pH regulation is dependent on the carbon source used and the mode of carbon catabolism; intracellular glycogen and exogenous sources of organic phosphorus and nitrogen usually provide useful sources of carbon; ubiquinone is an essential cofactor for energy generation via electron transfer, and thiosulfate reduction provides energy via electron flow as does the oxidation of carbon sources. Finally, colicins, antibiotics, and toxins can provide sources of nutrition under appropriate circumstances when other bacterial or eukaryotic cells are the targets of the action of these toxic agents.
Temperate bacteriophages such as phage P22 in S. typhimurium and phage λ in E. coli have evolved sensitivities to cytoplasmic levels of cAMP (66). This capability allows these parasites to sense the availability of carbon and energy and thereby choose between lysogeny and lysis. Thus, cya and crp mutants of the host bacteria are lysogenized at reduced frequency. Availability of a strong cAMP-CRP signal presumably tells the phage that carbon and energy are limiting and thus the bacteria may not possess sufficient resources to support production of a full burst of phage particles. Under these conditions, the phage therefore prefer to lysogenize. When the cAMP-CRP levels are low, a high level of carbon and energy availability is implied, thus signaling to the phage that the host should be capable of successfully supporting the production of a burst of phage. Lysis is therefore favored. This process provides an adaptive mechanism whereby the phages have evolved sensitivity to a cAMP signal in order to sense the metabolic state of the host cell.
Early reports suggested that cAMP influences catabolic enzyme synthesis at the translational level as well as the transcriptional level, both for tryptophanase synthesis and for β-galactosidase synthesis (1, 109). Subsequent workers (151) concluded that in the lac operon, only the promoter is a target of catabolite repression. Nevertheless, work on the gal operon has revealed that the cAMP-CRP complex influences synthesis of the three products of this operon differentially (2). The first gene within the gal operon encodes UDP galactose-4-epimerase (GalE), the second encodes galactose-1-phosphate uridylyltransferase (GalT), and the third encodes galactokinase (GalK). This operon possesses two promoters (PG2 and PG1) and two corresponding transcriptional start sites (S2 and S1, respectively). Transcription from S2 is negatively controlled by the cAMP-CRP complex, while transcription from S1 is positively controlled (2).
When transcription was studied in the presence of high cAMP so that promoter PG1 and start site S1 were used, the ratio of gal operon products was found to be GalE:GalT:GalK = 1:1:1. However, in the absence of cAMP, when promoter PG2 and start site S2 were used, the ratio of gal operon products was GalE:GalT:GalK = 2–4:1:1–0.5. This translational polarity, observed in the absence of cAMP-CRP, proved to be independent of the promoter and start site used but was suppressed by the presence of the cAMP-CRP complex. Mutations in the structural gene for the transcriptional terminator protein, Rho, increased the ratio of kinase to epimerase as did liganded CRP. It appears that intraoperonic transcriptional termination accounts for the polarity, and the cAMP-CRP complex somehow suppresses this phenomenon.
Forms of transcriptional regulation that manifest themselves as catabolite repression in response to cytoplasmic metabolites or extracellular stimuli have been shown to affect the synthesis of target enzymes and noncatalytic proteins independently of cAMP. In some cases, this repressive behavior has also been shown to be independent of inducer (see reference 93 for a brief summary of the evidence). For example, the repression of β-galactosidase synthesis by an inducer-independent mechanism can occur in cya or crp mutants of E. coli that are incapable of cAMP synthesis or action (37, 55, 164). The demonstration of this phenomenon required construction of bacterial strains that were capable of activating transcription of the lactose (lac) catabolic genes in the absence of cAMP or CRP. Synthesis of β-galactosidase in these mutants was found to be subject to the glucose effect, and this repressive response was shown to be particularly intense when the nitrogen source was limiting. These results showed that cAMP is not the only determinant of catabolite repression.
Further studies revealed that genes encoding several enzymes in E. coli, such as those for putrescine aminotransferase and pyrroline dehydrogenase, appear to be subject to carbon catabolite repression exclusively by mechanisms that are independent of cAMP (150). Moreover, in B. subtilis and other low-G+C gram-positive bacteria, cAMP levels are exceedingly low, and they do not vary in response to physiological conditions in a fashion that can account for the observed phenomenon of catabolite repression (91). These observations establish that cAMP-CRP-independent mechanisms of catabolite repression exist in both enteric and gram-positive bacteria, but they do not shed light on the mechanistic details. The next sections of this chapter serve to characterize to the extent possible the systems that appear to play a role in the cAMP-independent control of carbon utilization in bacteria that have been examined for these and related phenomena.
Key enzymes of most central carbohydrate metabolic pathways appear to be the targets of a novel cAMP-independent mechanism of catabolite repression in enteric bacteria (Fig. 3). In the presence of appropriate exogenous sugar substrates, expression of genes encoding enzymes of the glycolytic and Entner-Doudoroff pathways, including some genes encoding key proteins of the PTS, is activated, while expression of genes encoding key enzymes of gluconeogenic, glyoxalate shunt, and Krebs cycle pathways is inhibited. A specific protein, the repressor of the fructose (fru) regulon, FruR, regulates expression of all of these genes, thus repressing synthesis of key enzymes constituting the former pathways while activating synthesis of key enzymes of the latter three pathways (22, 23, 51, 118). Certain electron transfer proteins and Salmonella pathogenesis are also controlled by mechanisms that involve FruR (118, 142). It has been suggested that the proteins of the PTS may influence transcriptional regulation by FruR in response to the availability of exogenous carbohydrates (23), but this possibility is not favored (51).
FruR possesses a helix-turn-helix motif in its amino-terminal domain and belongs to a family of sugar-binding repressors that includes the LacI and GalR repressors of E. coli and the CcpA catabolite repression protein of B. subtilis (168, 172). Throughout its entire length, excluding the amino-terminal helix-turn-helix region, the amino acid sequence of FruR is homologous to those of several periplasmic sugar receptors, specific for ribose, arabinose, and galactose. The highest degree of similarity is observed between the sequences of FruR and the ribose-binding protein (73, 168).
The fruBKA operon of enteric bacteria encodes the enzymes involved in the fructose PTS. The first of these, FruB, is the diphosphoryl transfer protein, which includes an N-terminal IIAFru domain, a C-terminal HPr domain (FPr), and a central domain of unknown function (51, 52, 123, 176). The second, FruK, is a fructose-1-phosphate kinase (175). The third, FruA, is the fructose-specific enzyme II (IIB'BCFru) (176). Expression of the fru operon is negatively controlled by the fructose repressor, FruR.
The fruR gene is located at 2.2 min on the E. coli map, whereas the fru operon is located at approximately 47 min, an observation that in itself suggests that the fruR gene product does not function exclusively in fru operon expression regulation. fruR mutants were first isolated as suppressor mutations that allowed ptsH mutants to grow on PTS carbohydrates. Suppression results from constitutive synthesis of the HPr-like domain of the diphosphoryl transfer protein because it can substitute for HPr (79, 146, 160). S. typhimurium and E. coli fruR mutants exhibit an additional phenotype, the inability to grow on lactate, pyruvate, and all Krebs cycle intermediates (23, 118). This phenotype appears to be due to deficiencies in the gluconeogenic enzymes PEP synthase and PEP carboxykinase, enzymes of the Krebs cycle, the two glyoxalate shunt enzymes, and certain electron transfer carriers (22). High-level expression of PEP synthase or PEP carboxykinase permits only slow utilization of pyruvate or succinate, respectively, and does not reverse the fruR phenotype (V. Michotey and M. H. Saier, Jr., unpublished results).
In an S. typhimurium fruR mutant, activities of PEP carboxykinase, PEP synthase, fructose-1,6-bisphosphatase, isocitrate dehydrogenase, isocitrate lyase, and malate synthase varied from 5 to 46% of those in the broth-grown parental strain (22). Growth of the wild-type strain in the presence of glucose similarly depressed the activities of these enzymes. On the other hand, glycolytic enzymes such as enzyme I and HPr of the PTS, phosphofructokinase, and one of the two pyruvate kinase isozymes in enteric bacteria (PykF) exhibited elevated activities in fruR mutants or in the wild-type strain grown in the presence of glucose (22; S. Bledig, T. M. Ramseier, and M. H. Saier, Jr., unpublished results). It therefore appears that FruR serves as a switch, determining whether fermentative or oxidative and gluconeogenic conditions will prevail.
The results presented above suggest that FruR serves as a pleiotropic transcriptional regulator, activating some genes while repressing others. Recently, Ramseier et al. (120) overexpressed the fruR gene, and FruR was purified to homogeneity (24, 132a). By using the purified protein together with labeled DNA fragments corresponding to the regulatory regions of several operons, in vitro DNA binding studies were conducted to ascertain the nature of the DNA sequences to which FruR binds (118, 120). By using both DNA migration retardation assays and DNase I footprint analyses, FruR was found to bind to two operators within the regulatory region preceding the structural genes of the fructose operon, fruBKA. These two operators, O1 and O2, were found to comprise nearly identical palindromes of 12 bp with a half-site of TGAAAC. The two operators are located between the single putative promoter of the fructose operon and the translational initiation site of the fruB gene. Other regulated operons were shown to bind FruR to a single site upstream of the first structural gene as follows: (i) pckA encoding PEP carboxykinase (positive regulation); (ii) icd encoding isocitrate dehydrogenase (positive regulation); (iii) ace encoding the glyoxalate shunt enzymes (positive regulation); (iv) pps encoding PEP synthase (positive regulation); (v) pts encoding HPr and enzyme I of the PTS (negative regulation); (vi) edd-eda encoding the two enzymes of the Entner-Doudoroff pathway (negative regulation); (vii) gapB encoding the second putative glyceraldehyde-3-phosphate dehydrogenase (negative regulation); (viii) mtl encoding the mannitol-specific PTS enzymes (negative regulation); and (ix) pykF encoding one of the two pyruvate kinase isoenzymes (negative control) (Fig. 3) (118, 120; Bledig et al., unpublished results). The FruR-binding sites for all of these genes were determined, and a FruR consensus sequence was established. The current consensus sequence for FruR binding, taking all available data into account, is RSTGAAWCSNTHHW, where R is A or G, S is C or G, W is A or T, H is A, C, or T, and N is any nucleotide. Examination of the aligned operators revealed that the consensus sequence for FruR binding is the same for operons that are activated and repressed by FruR (118).
The positions of interference between FruR and the operator of the acetate (ace) and fru operons were examined more precisely, and the number and nature of the nucleotides essential for FruR binding were determined by several different techniques, including base methylation with dimethyl sulfate, base removal by formic acid and hydrazine, uracil interference, and hydroxyl radical footprinting. It was found that FruR asymmetrically binds to a 16-bp DNA sequence located 170 bp upstream from the transcriptional start site of the ace operon (24).
The FruR consensus sequence established by Ramseier et al. (118, 120; see above) agrees with the results published by Cortay et al. (24), showing that only one of the two FruR-binding half-sites within FruR-regulated operons is highly conserved. One can envisage the optimal binding site for FruR as two half-sites organized in a perfect palindromic structure. It is of interest that each half-site within this palindrome includes eight nucleotides, as do the operators that bind the homologous proteins, GalR, GalS, LacI, MalI, RbtR, and PurR. However, not all of this 16-nucleotide sequence appears to be recognized by FruR. An abbreviated nucleotide recognition sequence correlates nicely with the need for broad recognition of many operators by this pleiotropic regulatory protein.
In vitro FruR-DNA binding studies showed that micromolar concentrations of fructose 1-phosphate or millimolar concentrations of fructose 1,6-bisphosphate displaced the protein from the operator sites in the control regions of all FruR-regulated genes. This finding suggests that in the presence of fructose 1-phosphate or fructose 1,6-bisphosphate, operons under negative FruR control are derepressed whereas operons under positive FruR control are not activated. A model for FruR-mediated repression and activation of target genes and for FruR-mediated derepression and deactivation of target genes in the presence of effector molecules is shown in Fig. 4.
Further analyses are now required to characterize the mechanism by which FruR transcriptionally activates gene expression of operons in which the binding site is upstream of and distant from the transcriptional start point (Fig. 4). It seems reasonable to expect that the mode of FruR action resembles that of CRP activation, in which binding of the protein bends the DNA, facilitating direct contact of this protein with RNA polymerase (see section entitled "Mechanism of Action of the cAMP-CRP Complex").
Recently, the fruR gene of E. coli was cloned in the pT7-5 expression vector so as to overproduce a protein tagged with six histidine residues (24). By using a one-step chromatographic procedure, FruR was purified to homogeneity. Analysis of the protein under both denaturing and nondenaturing conditions indicated that, like its homolog LacI, it is a tetramer, with a molecular mass of about 150 kDa.
To assess the physiological effect of FruR on gene expression, single-copy transcriptional lacZ fusions were constructed in the λatt site of the E. coli chromosome to (i) ppsA, (ii) gapB, (iii) edd, (iv) mtlA, and (v) fruR itself. Of these fusions, the following exhibited increased β-galactosidase activity in a fruR mutant relative to the isogenic E. coli parent: fruR (twofold), gapB (fourfold), mtlA (twofold), and edd (threefold). By contrast, the ppsA fusion exhibited an 11-fold decrease, to 9%, in a fruR genetic background compared with wild-type β-galactosidase activity (118).
The effects of glucose on the β-galactosidase activities of these fusions were also studied. Glucose decreased the β-galactosidase activity of the ppsA-lacZ and fruR-lacZ fusion strains in a wild-type genetic background but increased the activities of all other fusions mentioned. A fruR mutation substantially diminished the repressive or inductive effects of glucose on the residual activities of these fusions. These results led to the tentative conclusion that when FruR functions as an activator, it mediates catabolite repression, but when it functions as a repressor, it mediates glucose-promoted activation. Although the effector molecule that displaces FruR from the DNA has not been identified in vivo, it may be fructose 1-phosphate and/or fructose 1,6-bisphosphate (118, 120).
Further examination of the β-galactosidase activities of these reporter gene fusion-bearing strains as the cells entered stationary phase revealed that the activity observed for the fruR-lacZ fusion increased whereas the activities observed for representative FruR-repressed fusion genes decreased. This was true of both the edd-lacZ and gapB-lacZ fusion strains (118). The increase in fruR expression observed upon entry into the stationary growth phase can directly account for the increased repression observed for the edd and gapB catabolic operons. These observations provide a novel mechanistic explanation for alterations in carbon catabolic gene expression as a function of growth state. However, the mechanistic basis for increased fruR expression as cells enter stationary phase has yet to be determined. It is possible that the fruR gene can be transcribed by RNA polymerase to which a stationary-phase sigma factor such as σ S is bound in addition to the σ 70-RNA polymerase holoenzyme (see next section). Alternatively, DNA supercoiling, which is known to be influenced by growth stage (11, 65), may influence the expression of the fruR gene.
To determine if the loss of FruR function impairs the utilization of various carbon sources, an E. coli fruR mutant and its isogenic parent were tested for the ability to oxidize 84 compounds (118). Of these 84 compounds, 36 proved to be oxidized at a substantially different rate in the mutant compared with the isogenic wild-type strain. Nineteen of these compounds were oxidized more rapidly by the fruR mutant (carbon sources negatively regulated by FruR), while 17 were oxidized more slowly or not at all (carbon sources positively regulated by FruR). Those systems that were subject to negative regulation by FruR were without exception sugars or sugar derivatives. All but a few of the carbon sources whose oxidation proved to be positively regulated by FruR were gluconeogenic substances. Thus, rates of oxidation of glycolytic substances were enhanced, while oxidation rates of gluconeogenic substances were depressed. These observations led to the conclusion that FruR plays a pleiotropic role in regulating the utilization of a major fraction of the carbon sources used by E. coli. They further indicated that FruR modulates the direction of carbon flow through the different metabolic pathways by transcriptional activation of key enzymes concerned with oxidative and gluconeogenic carbon flow and by repression of key enzymes concerned with fermentative carbon flow.
In summary, FruR can bind upstream of certain promoters to activate their expression and can bind to sites overlapping other promoters to block transcription. Fructose phosphates interact with FruR to prevent its binding to these sites. The presence of fructose or glucose presumably increases the intracellular concentrations of the fructose phosphates and consequently prevents binding of FruR to its sites in the promoter regions of target operons. As a result, glucose may partially block the initiation of transcription at promoters requiring activation by FruR, thus mediating catabolite repression, and it promotes the initiation of transcription at promoters where FruR blocks the initiation of transcription. Because glycolytic enzymes are repressed by FruR whereas gluconeogenic and oxidative enzymes are activated by FruR, glucose induces the former while repressing the latter.
Several genes that confer resistance to stress or starvation conditions in E. coli are subject to cAMP-independent, carbon starvation-induced expression, a phenomenon that is potentially related to the reciprocal phenomenon of catabolite repression (78, 96, 97). Some of the target genes, designated pex or csi, are induced in response to starvation for carbon, nitrogen, or phosphorus or to stress conditions such as heat, oxidation, or strong acidity (81, 95, 97). These genes appear to be transcribed by RNA polymerase containing minor, stationary-phase-specific sigma factors such as the stress- and starvation-induced σ 32 (also referred to as RpoH) (74) and the putative starvation-induced σ S (also called σ 38, RpoS, KatF, and AppR [61, 81, 82, 162]). σ S synthesis occurs in response to starvation for carbon, phosphorus, or amino acids and is dependent on guanosine tetraphosphate (ppGpp) (53). Its synthesis is regulated transcriptionally, translationally, and posttranslationally (61, 62, 88, 98). Some of the genes under σ S control are also subject to regulation by the cAMP-CRP complex (81). This topic will be discussed only briefly here in the context of the regulation of carbon utilization. A more comprehensive treatment can be found in this volume (chapter 93).
Induced synthesis of σ S constitutes a novel mechanism for overcoming catabolite repression, essentially by allowing its release. Thus, a gene may be expressed under condition of carbon limitation either by the action of the vegetative σ 70-RNA polymerase holoenzyme in a cAMP-CRP complex-dependent fashion or by the action of the stationary-phase σ S-RNA polymerase holoenzyme in a cAMP-CRP complex-independent fashion. Such a mechanism can account for the enhanced expression of specific genes that occurs as cells enter the stationary growth phase when a nutrient becomes depleted from the growth medium.
Recent evidence substantiates the suggestion that σ S overlaps functionally with σ 70 (see reference 78). It seems likely that some carbon catabolic genes under σ 70 and cAMP-CRP control are also under σ S control. When σ S binds to RNA polymerase, expression of the target promoter becomes independent of cAMP-CRP. Such a mechanism would allow relief of carbon catabolite repression by a cAMP-independent mechanism as cells enter the stationary growth phase. Since σ S synthesis is regulated positively by ppGpp, which increases in amount as cells enter stationary phase (53), and since σ S synthesis may similarly be positively responsive to organic acids such as acetate that also accumulate in stationary phase (149), these cytoplasmic compounds may be important to the stationary phase release of catabolite repression.
In this regard, it is worth noting that among the more than 30 σ S-dependent operons (99), several are concerned with carbon metabolism (78, 99). These include the treA gene encoding periplasmic trehalase (63), otsAB encoding trehalose synthase (63), cyxAB encoding a novel cytochrome oxidase distinct from the cytochrome d and cytochrome o oxidases (34), the glgS gene concerned with glycogen synthesis (62), and a number of genes encoding carbohydrate uptake systems (8).
Recently Lomovskaya et al. (89) have examined the transcriptional regulation of a gene, designated pexB, that encodes a novel DNA-binding protein with regulatory and protective roles in E. coli (9). By using a pexB-lacZ transcriptional fusion, it was shown that induction in response to carbon starvation occurs at the transcriptional level and is under σ S control, although induction in response to nitrogen starvation proved to occur posttranscriptionally. The promoter region was found to contain a consensus CRP-binding site, but deletion of this site did not affect starvation induction. It appeared that the same transcriptional start site was used by both σ 70- and σ S-RNA polymerase holoenzymes.
Farr et al. (47) have examined the physiological consequences of an apaH mutation that causes the unusual dinucleotide AppppA to accumulate more than 16-fold in the cytoplasm of E. coli. The apaH mutant was nonmotile, produced decreased levels of several motility and chemotaxis gene products, and essentially lacked detectable activity of σ F (σ 28), an RNA polymerase sigma factor that is required for the transcription of several motility and chemotaxis genes (60). Since motility and chemotaxis genes are subject to catabolite repression in a cAMP-CRP-dependent fashion (47, 128), relief from catabolite repression of these genes may be mediated by σ F just as σ S may mediate relief from catabolite repression of starvation-induced genes as noted above. The presence in E. coli of an anti-σ F protein, FlgM, that can be expelled from the cell into the medium in the presence of an intact flagellar basal body (67) complicates this issue but probably has nothing to do with catabolite repression. The presence of anti-sigma factor proteins in B. subtilis is well established (14, 41).
The E. coli apaH mutant discussed above was shown to be altered with respect to the expression of several catabolite-repressible genes. Among the genes tested were lacZ of the lactose operon and galK of the galactose operon. Both genes appeared to be poorly expressed in the apaH mutant (47). Poor fermentation of carbon sources such as arabinose and maltose suggested that elevated levels of AppppA may enhance sensitivity of many cAMP-CRP-dependent operons to catabolite repression. A mechanistic explanation for these observations is not yet available.
E. coli possesses an operon of four cistrons, creABCD (cre refers to catabolite regulator, so named because of its presumed involvement in regulating gene expression in response to environmental catabolites) (170). The CreC and CreB proteins constitute a sensor kinase-response regulator pair homologous to numerous other bacterial two-component regulatory systems (106, 107, 137, 139, 140, 157). CreC was previously called PhoM, since it was first detected on the basis of "cross talk" with PhoB, the response regulator of the phosphate (pho) regulon (170). In fact, the sensor kinase and response regulator of the pho regulon, PhoR and PhoB, respectively, exhibit striking sequence similarity to CreC and CreB, thus accounting for the observed cross talk (105).
By using lacZ fusions, the effects of various mutations and physiological conditions on phoA (alkaline phosphatase) and creA gene expression have been studied in phoR genetic backgrounds. The results revealed that some of the factors which affect phoA gene expression also regulate creA gene expression but in opposite ways. phoA expression was promoted by both CreC-dependent and CreC-independent mechanisms, and only the CreC-independent processes altered cre operon expression. Thus, on glucose minimal medium or in a crp, cya, or pts genetic background, CreC-dependent phoA expression was high, whereas cre operon expression was unaffected, relative to growth in complex medium without glucose. It appeared that introduction of a crp, cya, or pts mutation had the same effect as the presence of glucose.
All of these conditions and mutations are known to lower cytoplasmic cAMP-CRP levels, suggesting that CreC may respond either directly or indirectly to cellular cAMP concentrations via CRP. Under these conditions, phoA expression is absolutely dependent on creC as well as phoB. Some evidence suggested that glycolytic intermediates such as 1,3-diphosphoglycerate may be sensed by CreC, but the physiologically relevant targets of CreC-CreB action have not yet been identified. Other conditions that promote CreC-independent phoA gene expression, and that appear to be linked to mixed acid fermentation, affect cre transcription (B. L. Wanner, personal communication). Further studies will be required to identify the targets of CreC-CreB action and to determine the relationship of the CreC and CreB proteins to physiologically relevant metabolic regulation. The implied relationship between the Cre- and cAMP-CRP-dependent systems suggests that different types of regulatory systems may interact and thereby overlap functionally.
In addition to the processes already discussed, several currently recognized factors may well prove to participate in the phenomenon of catabolite repression or its converse, starvation induction. Some of these have been briefly mentioned in previous sections of this chapter. The first of these factors is ppGpp (177). Relief from catabolite repression upon starvation for a carbon source may involve cytoplasmic ppGpp, since an increase in cytoplasmic ppGpp levels has been shown to correlate with the onset of starvation, and this nucleotide influences the intensity of catabolite repression (101). The second of these factors is AppppA. Increased levels of this dinucleotide depress the levels of tested catabolite-repressible enzymes (47). A third potential factor is indole-3-acetic acid, which activates transcription of catabolic enzymes in the absence of cAMP or CRP (42, 76). A fourth possible factor is α-ketobutyrate, which has been reported to influence growth, catabolic gene expression, and PTS-regulated adenylate cyclase activity in E. coli under certain conditions (29, 31, 32). These effects may be attributable to a direct inhibitory effect of α-ketobutyrate on the PTS (30). A fifth possible agent is a poorly characterized factor termed catabolite modulator factor (165). The sixth and final potential factor to be mentioned is DNA topology. Plasmids isolated from starved, stationary-phase cells have been found to be relaxed, and DNA supercoiling is known to influence gene expression (11, 65). There is at present little evidence that these factors play a direct role in mediating catabolite repression, but this possibility as well as that of potential indirect mechanisms must be considered by future investigators.
Intracellular homeostasis was one of the principal themes upon which early studies of biochemical, physiological, and genetic regulation in bacteria were based. When the notion of genetic regulation was first propounded, it was of primary interest to know how a cell could switch from one condition to another with maximal efficiency and minimal energy expenditure. Studies on the lac operon of E. coli fostered much interest, but molecular biology is little different from other sciences in being faddish, and on the assumption that lac regulation was understood and would be applicable to other bacterial operons, interest shifted to topics in eukaryotic molecular biology, leaving many unanswered questions in prokaryotic molecular biology to gather dust. The scientific community remains more or less ignorant of the fact that the "prototype" operon is far from understood and that its primary mode of regulation is not representative of many other superficially similar operons.
As illustrated in this chapter, the mechanisms of cAMP-independent catabolite repression and cytoplasmic inducer control in E. coli and S. typhimurium are clearly defined but still incompletely understood. It is clear that in eubacteria, multiple mechanisms are operative. Only one mechanism of catabolite repression, the cAMP-dependent mechanism, involving an operon-specific repressor or activator protein acting together with CRP in enteric bacteria, is reasonably well understood. On the basis of fragmentary evidence, we are now at a stage which allows us to predict the nature of several alternative catabolite repression mechanisms in various bacteria. One of these may involve direct phosphorylation and activation of regulatory proteins, enzymes, and permeases which generate cytoplasmic inducers in low-G+C gram-positive bacteria (38, 39, 40, 178, 179, 180, 181, 182, 183); a second may utilize the FruR protein of E. coli to regulate central pathways of carbon metabolism in response to carbon source availability; a third involves starvation-induced synthesis of novel sigma factors; and a fourth may utilize specific sensor kinases and response regulators to directly or indirectly sense the availability of carbon sources (Table 1).
To further exemplify the insufficiency of our knowledge regarding repressive phenomena in bacteria, the well-documented phenomenon of transient repression is still unexplained at the mechanistic level, and the observation that carbon catabolite repression increases in intensity when nitrogen is limiting for growth still goes without mechanistic clarification. The recent discovery that the rpoN operon of E. coli, encoding the nitrogen starvation sigma factor σ 54, also encodes two proteins homologous to recognized PTS proteins (100) has led to the prediction that these proteins link carbon metabolism to nitrogen assimilation (125). One of these two proteins resembles in sequence the fructose-specific IIA protein and has been termed the nitrogen regulatory IIA; the other is homologous to HPr and is termed the nitrogen-regulatory HPr. Both of these proteins have been purified and shown to be phosphorylated by PEP in a PTS-dependent reaction (116). Insertional loss of the former protein has recently been shown to prevent the utilization of organic nitrogen sources such as alanine in the presence of a carbon source such as glucose. It inhibits but does not block the utilization of alanine when this nutrient is present alone in the culture medium as the sole source of carbon and nitrogen (116). It seems probable that these observations will find explanations based on the interactions of dissimilar regulatory systems.
Just as nitrogen metabolism is apparently linked to carbon metabolism, a recent report has provided genetic evidence for the proposal that phosphorus metabolism in E. coli is linked to carbon metabolism (57). Mutants defective in phoB, the positive gene activator of the E. coli pho regulon, were shown to exhibit aberrant behavior on MacConkey indicator plates containing a carbohydrate. Mutant colonies appeared pale in the presence of a fermentable carbon source such as trehalose, maltose, or glucose, and the addition of 5 mM phosphate was found to correct this defect. Moreover, colonies of phoB + strains turned red on MacConkey indicator plates and derepressed the pho regulon when the cells were able to ferment the carbon source in the presence of low concentrations of extracellular phosphate. Reciprocally, the inability to ferment the carbon source was found to correlate with maintenance of the pho regulon in the repressed state (57). These observations suggest that a regulatory mechanism links phosphorus and carbon metabolic processes, but the mechanistic details remain unknown.
The final question concerns the applicability of studies of catabolite repression, inducer exclusion, and inducer expulsion in E. coli and S. typhimurium to the same phenomena in other bacteria. Recent studies have established that these phenomena, while superficially similar in many bacteria, are mechanistically distinct in evolutionarily divergent bacteria. Thus, in low-G+C gram-positive bacteria, inducer exclusion and expulsion are mediated by a metabolite-activated, ATP-dependent, HPr(ser) kinase. The product of the kinase-catalyzed reaction, HPr(ser-P), controls inducer levels and the severity of catabolite repression (39, 178, 179, 180, 181, 182, 183; see reference 141 for a review). In high-G+C gram-positive bacteria, a totally different set of mechanisms may be operative (10, 80). Finally, in species of Azospirillum and Rhodobacter, the phenomenon of reverse catabolite repression, in which the utilization of Krebs cycle intermediates prevents the utilization of sugars, appears to be subject to still another mechanism of control (19, 119). It is clear that our understanding of catabolite repression mechanisms in bacteria, as in eukaryotes, is still in its infancy. Much more work will be required before we have a detailed understanding of these multifaceted phenomena.
We thank Abdul Matin, Brad Powell, and Barry Wanner for providing manuscripts and information prior to publication and Mary Beth Hiller for providing expert word processing assistance. Work in our laboratory was supported by Public Health Service grants 5RO1AI21702 and 2RO1AI14176 from the National Institute of Allergy and Infectious Diseases.
The FruR protein has recently been renamed the catabolite repressor/activator (Cra) protein. The gapB gene of E. coli, under Cra transcriptional regulatory control (see Fig. 3 ), has recently been shown to encode erythrose- 4-phosphate dehydrogenase (G. Zhao, A. J. Pease, N. Bharani, and M. E. Winkler, J. Bacteriol. 177: 2804–2812).
References
1. Aboud, M., and M. Burger. 1970. The effect of catabolite repression and of cyclic 3',5' adenosine monophosphate on the translation of the lactose messenger RNA in Escherichia coli. Biochem. Biophys. Res. Commun. 38:1023–1032.
2. Adhya, S. 1987. The galactose operon, p. 1503–1512. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D.C.
3. Adhya, S., and S. Garges. 1990. Positive control. J. Biol. Chem. 265:10797–10800.
4. Aiba, H. 1983. Autoregulation of the Escherichia coli crp gene: Crp is a transcriptional repressor of its own gene. Cell 32:141–149.
5. Aiba, H. 1984. Transcription of the Escherichia coli adenylate cyclase gene is negatively regulated by cAMP-cAMP receptor protein. J. Biol. Chem. 260:3063–3070.
6. Aiba, H., S. Fujimoto, and N. Ozaki. 1982. Molecular cloning and sequencing of the gene for E. coli cAMP receptor protein. Nucleic Acids Res. 10:1345–1362.
7. Aiba, H., K. Naori, M. Tanaka, T. Ooi, A. Tooy, and A. Danchin. 1984. The complete sequence of the adenylate cyclase gene of Escherichia coli. Nucleic Acids Res. 12:9427–9439.
8. Alexander, D. M., K. Damerau, and A. C. St. John. 1993. Carbohydrate uptake genes in Escherichia coli are induced by carbon starvation. Curr. Microbiol. 27:335–340.
9. Almiron, M., A. J. Link, D. Furlong, and R. Kolter. 1992. A novel DNA-binding protein with regulatory and protective roles in starved Escherichia coli. Genes Dev. 6:2646–2654.
10. Angell, A., E. Schwarz, and M. J. Bibb. 1992. The glucose kinase gene of Streptomyces coelicolor A3(2): its nucleotide sequence, transcriptional analysis and role in glucose repression. Mol. Microbiol. 6:2833–2844.
11. Balke, V. L., and J. D. Gralla. 1987. Changes in the linking number of supercoiled DNA accompany growth transitions in Escherichia coli. J. Bacteriol. 169:4499–4506.
12. Bankaitis, V. A., and P. J. Bassford. 1982. Regulation of adenylate cyclase synthesis in Escherichia coli: studies with cya-lac operon and protein fusions. J. Bacteriol. 151:1346–1357.
13. Barber, A. M., V. B. Zhurkin, and S. Adhya. 1993. CRP-binding sites: evidence for two structural classes with 6-bp and 8-bp spacers. Gene 130:1–8.
14. Benson, A. K., and W. G. Haldenwang. 1993. Bacillus subtilis σB is regulated by a binding protein (RsbW) that blocks its association with core RNA polymerase. Proc. Natl. Acad. Sci. USA 90:2330–2334.
15. Berg, O. G., and P. H. von Hippel. 1988. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. J. Mol. Biol. 200:709–723.
16. Blazy, B., M. Takahashi, and A. Baudras. 1980. Binding of CRP to DNA-dependent RNA polymerase from E. coli: modulation by cAMP of the interactions with free and DNA-bound holo and core enzyme. Mol. Biol. Rep. 6:39–43.
17. Blum, P. H., S. B. Jovanovitch, M. P. McCann, J. E. Schultz, S. A. Lesley, R. R. Burgess, and A. A. Matin. 1990. Cloning and in vivo and in vitro regulation of cyclic AMP-dependent starvation genes from Escherichia coli. J. Bacteriol. 172:3813–3820.
18. Botsford, J. L., and J. G. Harman. 1992. Cyclic AMP in prokaryotes. Microbiol. Rev. 56:100–122.
19. Chattopadhyay, S., A. Mukherjee, and S. Ghosh. 1994. Molecular cloning and sequencing of an operon, carRS of Azospirillum brasilense, that codes for a novel two-component regulatory system: demonstration of a positive regulatory role of carR for global control of carbohydrate catabolism. J. Bacteriol. 176:7484–7490.
20. Chen, Y., W. J. Fairbrother, and P. E. Wright. 1993. Three-dimensional structures of the central regulatory proteins of the bacterial phosphotransferase system, HPr and Enzyme IIAGlc. J. Cell. Biochem. 51:75–82.
21. Chen, Y., J. Reizer, M. H. Saier, Jr., W. J. Fairbrother, and P. E. Wright. 1993. Mapping of the binding interfaces of the proteins of the bacterial phosphotransferase system, HPr and IIAGlc. Biochemistry 32:32–37.
22. Chin, A. M., D. A. Feldheim, and M. H. Saier, Jr. 1989. Altered transcriptional patterns affecting several metabolic pathways in strains of Salmonella typhimurium which overexpress the fructose regulon. J. Bacteriol. 171:2424–2434.
23. Chin, A. M., B. U. Feucht, and M. H. Saier, Jr. 1987. Evidence for the regulation of gluconeogenesis by the fructose phosphotransferase system in Salmonella typhimurium. J. Bacteriol. 169:897–899.
24. Cortay, J.-C., D. Nègre, M. Scarabel, T. M. Ramseier, N. B. Vartak, J. Reizer, M. H. Saier, Jr., and A. J. Cozzone. 1994. In vitro asymmetric binding of the pleiotropic regulatory protein, FruR, to the ace operator controlling glyoxylate shunt enzyme synthesis. J. Biol. Chem. 269:14885–14891.
25. Cossart, P., and B. Gicquel-Sanzey. 1985. Regulation of expression of the crp gene of Escherichia coli K-12. J. Bacteriol. 161:454–457.
26. Crasnier, M., and A. Danchin. 1990. Characterization of Escherichia coli mutants with altered regulation. J. Gen. Microbiol. 136:1825–1832.
27. Crasnier, M., V. Dumay, and A. Danchin. 1994. The catalytic domain of Escherichia coli K-12 adenylate cyclase as revealed by deletion analysis of the cya gene. Mol. Gen. Genet. 241:409–416.
28. Dalma-Weiszhausz, D. D., M. R. Gartenberg, and D. M. Crothers. 1991. Sequence-dependent contribution of distal binding domains to CAP protein-DNA binding affinity. Nucleic Acids Res. 19:611–616.
29. Danchin, A., and L. Dondon. 1980. Serine sensitivity of Escherichia coli K12: partial characterization of a serine resistant mutant that is extremely sensitive to 2-ketobutyrate. Mol. Gen. Genet. 178:155–164.
30. Danchin, A., L. Dondon, and J. Daniel. 1984. Metabolic alterations mediated by 2-ketobutyrate in Escherichia coli K12. Mol. Gen. Genet. 193:473–478.
31. Daniel, J., L. Dondon, and A. Danchin. 1983. 2-Ketobutyrate: a putative alarmone of Escherichia coli. Mol. Gen. Genet. 190:452–458.
32. Daniel, J., E. Joseph, and A. Danchin. 1984. Role of 2-ketobutyrate as an alarmone in E. coli K12: inhibition of adenylate cyclase activity mediated by the phosphoenolpyruvate: glycose phosphotransferase transport system. Mol. Gen. Genet. 193:467–472.
33. D’Ari, R., A. Jaffe, P. Bouloc, and A. Robin. 1988. Cyclic AMP and cell division in Escherichia coli. J. Bacteriol. 170:65–70.
34. Dassa, J., H. Fsihi, C. Marck, M. Dion, M. Kieffer-Bontemps, and P. L. Boquet. 1992. A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA). Mol. Gen. Genet. 229:342–352.
35. Dean, D. A., J. Reizer, H. Nikaido, and M. H. Saier, Jr. 1990. Regulation of the maltose transport system of Escherichia coli by the glucose-specific enzyme III of the PTS: characterization of inducer exclusion-resistant mutants and reconstitution of inducer exclusion in proteoliposomes. J. Biol. Chem. 265:21005–21010.
36. Den Blaauwen, J. L., and P. W. Postma. 1985. Regulation of cyclic AMP synthesis by enzyme IIIGlc of the phosphoenolpyruvate:sugar phosphotransferase system in crp strains of Salmonella typhimurium. J. Bacteriol. 164:477–478.
37. Dessein, A., M. Schwartz, and A. Ullmann. 1978. Catabolite repression in Escherichia coli mutants lacking cyclic AMP. Mol. Gen. Genet. 162:83–87.
38. Deutscher, J. 1985. Phosphoenolpyruvate-dependent phosphorylation of a 55-kDa protein of Streptococcus faecalis catalyzed by the phosphotransferase system. FEMS Microbiol. Lett. 29:237–243.
39. Deutscher, J., J. Reizer, C. Fischer, A. Galinier, M. H. Saier, Jr., and M. Steinmetz. 1994. Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis. J. Bacteriol. 176:3336–3344.
40. Deutscher, J., and H. Sauerwald. 1986. Stimulation of dihydroxyacetone and glycerol kinase activity in Streptococcus faecalis by phosphoenolpyruvate-dependent phosphorylation catalyzed by enzyme I and HPr of the phosphotransferase system. J. Bacteriol. 166:829–836.
41. Duncan, L., and R. Losick. 1993. SpoIIAB is an anti-σ factor that binds to and inhibits transcription by regulatory protein σF from Bacillus subtilis. Proc. Natl. Acad. Sci. USA 90:2325–2329.
42. Ebright, R. H., and J. Beckwith. 1985. The catabolite gene activator protein (CAP) is not required for indole-3-acetic acid to activate transcription of the araBAD operon of Escherichia coli K-12. Mol. Gen. Genet. 201:51–55.
43. Ebright, R. H., Y. W. Ebright, and A. Gunasekera. 1989. Consensus DNA site for the Escherichia coli catabolite gene activator protein (CAP): CAP exhibits a 450-fold higher affinity for the consensus DNA site than for the lac DNA site. Nucleic Acids Res. 17:10295–10305.
44. Fairbrother, W. J., J. Cavanagh, H. J. Dyson, A. G. Palmer, III, S. Sutrina, J. Reizer, M. H. Saier, Jr., and P. E. Wright. 1991. Polypeptide backbone resonance assignments and secondary structure of Bacillus subtilis Enzyme IIIglc determined by two-dimensional and three-dimensional heteronuclear NMR spectroscopy. Biochemistry 30:6896–6907.
45. Fairbrother, W. J., G. P. Gippert, J. Reizer, M. H. Saier, Jr., and P. E. Wright. 1992. Low resolution solution structure of the Bacillus subtilis glucose permease IIA domain derived from heteronuclear three-dimensional NMR spectroscopy. FEBS Letts. 296:148–152.
46. Fairbrother, W. J., A. G. Palmer, III, M. Rance, J. Reizer, M. H. Saier, Jr., and P. E. Wright. 1992. Assignment of the aliphatic 1H and 13C resonances of the Bacillus subtilis glucose permease IIA domain using double- and triple-resonance heteronuclear three-dimensional NMR spectroscopy. Biochemistry 31:4413–4425.
47. Farr, S. B., D. N. Arnosti, M. J. Chamberlin, and B. N. Ames. 1989. An apaH mutation causes AppppA to accumulate and affects motility and catabolite repression in Escherichia coli. Proc. Natl. Acad. Sci. USA 86:5010–5014.
48. Feldheim, D. A., A. M. Chin, C. T. Nierva, B. U. Feucht, Y. W. Cao, Y. F. Xu, S. L. Sutrina, and M. H. Saier, Jr. 1990. Physiological consequences of the complete loss of phosphoryl-transfer proteins HPr and FPr of the phosphoenolpyruvate:sugar phosphotransferase system and analysis of fructose (fru) operon expression in Salmonella typhimurium. J. Bacteriol. 172:5459–5469.
49. Feucht, B. U., and M. H. Saier, Jr. 1980. Fine control of adenylate cyclase by the phosphoenolpyruvate:sugar phosphotransferase systems in Escherichia coli and Salmonella typhimurium. J. Bacteriol. 141:603–610.
50. Gaston, K., A. Bell, A. Kolb, H. Buc, and S. Busby. 1990. Stringent spacing requirements for transcription activation by CRP. Cell 62:733–743.
51. Geerse, R. H., F. Izzo, and P. W. Postma. 1989. The PEP:fructose phosphotransferase system in Salmonella typhimurium: FPr combines Enzyme IIIfru and pseudo-HPr activities. Mol. Gen. Genet. 216:517–525.
52. Geerse, R. H., J. Van der Pluijm, and P. W. Postma. 1989. The repressor of the PEP:fructose phosphotransferase system is required for the transcription of the pps gene of Escherichia coli. Mol. Gen. Genet. 218:348–352.
53. Gentry, D. R., V. J. Hernandez, L. H. Nguyen, D. B. Jensen, and M. Cashel. 1993. Synthesis of the stationary-phase sigma factor σS is positively regulated by ppGpp. J. Bacteriol. 175:7982–7989.
54. Gershanovitch, V. N., T. N. Bolshakova, M. L. Molchanova, A. M. Umyarov, O. Y. Dobrynina, Y. A. Grigorenko, and R. S. Erlagaeva. 1989. Fructose-specific phosphoenolpyruvate dependent phosphotransferase system of Escherichia coli: its alterations and adenylate cyclase activity. FEMS Microbiol. Rev. 63:125–134.
55. Guidi-Rontani, C., A. Danchin, and A. Ullmann. 1980. Catabolite repression in Escherichia coli mutants lacking cyclic AMP receptor protein. Proc. Natl. Acad. Sci. USA 77:5799–5801.
56. Hanamura, A., and H. Aiba. 1992. A new aspect of transcriptional control of the Escherichia coli crp gene: positive autoregulation. Mol. Microbiol. 6:2489–2497.
57. Hartmann, A., and W. Boos. 1993. Mutations in phoB, the positive gene activator of the pho regulon in Escherichia coli, affect the carbohydrate phenotype on MacConkey indicator plates. Res. Microbiol. 144:285–293.
58. Harwood, J. P., C. Gazdar, C. Prasad, A. Peterkofsky, S. J. Curtis, and W. Epstein. 1976. Involvement of the glucose Enzymes II of the sugar phosphotransferase system in the regulation of adenylate cyclase by glucose in Escherichia coli. J. Biol. Chem. 251:2462–2468.
59. Harwood, J. P., and A. Peterkofsky. 1975. Glucose-sensitive adenylate cyclase in toluene-treated cells of Escherichia coli B. J. Biol. Chem. 250:4656–4662.
60. Helmann, J. D. 1991. Alternative sigma factors and the regulation of flagellar gene expression. Mol. Microbiol. 5:2875–2882.
61. Hengge-Aronis, R. 1993. Survival of hunger and stress: the role of rpoS in early stationary phase gene regulation in Escherichia coli. Cell 72:165–168.
62. Hengge-Aronis, R., and D. Fischer. 1992. Identification and molecular analysis of glgS, a novel growth-phase-regulated and rpoS-dependent gene involved in glycogen synthesis in Escherichia coli. Mol. Microbiol. 6:1877–1886.
63. Hengge-Aronis, R., W. Klein, R. Lange, M. Rimmele, and W. Boos. 1991. Trehalose synthesis genes are controlled by the putative sigma factor encoded by rpoS and are involved in stationary phase thermotolerance in Escherichia coli. J. Bacteriol. 173:7918–7924.
64. Herzberg, O., P. Reddy, S. Sutrina, M. H. Saier, Jr., J. Reizer, and G. Kapadia. 1992. Structure of the histidine-containing phosphocarrier protein HPr from Bacillus subtilis at 2.0 Å resolution. Proc. Natl. Acad. Sci. USA 89:2499–2503.
65. Higgins, C. F., C. J. Dorman, D. A. Stirling, L. Waddell, I. R. Booth, G. May, and E. Bremer. 1988. A physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. typhimurium and E. coli. Cell 52:569–584.
66. Hong, J.-S., G. R. Smith, and B. N. Ames. 1971. Adenosine 3':5'-cyclic monophosphate concentration in the bacterial host regulates the viral decision between lysogeny and lysis. Proc. Natl. Acad. Sci. USA 68:2258–2262.
67. Hughes, K. T., K. L. Gillen, M. J. Semon, and J. E. Karlinsey. 1993. Sensing structural intermediates in bacterial flagellar assembly by export of a negative regulator. Science 262:1277–1280.
68. Hughes, P., A. Landoulsi, and M. Kohiyama. 1988. A novel role for cAMP in the control of the activity of the E. coli chromosome replication initiator protein, DnaA. Cell 55:343–350.
69. Hurley, J. H., H. R. Faber, D. Worthylake, N. D. Meadow, S. Roseman, D. W. Pettigrew, and S. J. Remington. 1993. Structure of the regulatory complex of Escherichia coli IIIglc with glycerol kinase. Science 259:673–677.
70. Igarashi, K., A. Hanamura, K. Makino, H. Aiba, H. Aiba, T. Mizuno, A. Nakata, and A. Ishihama. 1991. Functional map of the α subunit of Escherichia coli RNA polymerase. Two modes of transcription activation by positive factors. Proc. Natl. Acad. Sci. USA 88:8958–8962.
71. Igarashi, K., and A. Ishihama. 1991. Bipartite functional map of the E. coli RNA polymerase α subunit: involvement of the C-terminal region in transcription activation by cAMP-CAP. Cell 65:1015–1022.
72. Ishizuka, H., A. Hanamura, T. Kunimura, and H. Aiba. 1993. A lowered concentration of cAMP receptor protein caused by glucose is an important determinant for catabolite repression in Escherichia coli. Mol. Microbiol. 10:341–350.
73. Jahreis, K., P. W. Postma, and J. W. Lengeler. 1991. Nucleotide sequence of the ilvH-fruR gene region of Escherichia coli K12 and Salmonella typhimurium LT2. Mol. Gen. Genet. 226:332–336.
74. Jenkins, D. E., E. A. Auger, and A. Matin. 1991. Role of RpoH, a heat-shock regulator protein, in carbon starvation protein synthesis and survival of Escherichia coli. J. Bacteriol. 173:1992–1996.
75. Kawanyjaum, M., J. Kishimoto, R. Utsumi, M. Himero, T. Komano, and H. Aiba. 1985. Negative regulation of adenylate cyclase gene (cya) expression by cyclic AMP-cyclic AMP receptor protein in Escherichia coli: studies with cya-lac protein and operon fusions. J. Bacteriol. 164:872–877.
76. Kline, E., C. Brown, V. Bankaitis, D. Montefiori, and K. Craig. 1980. Metabolite gene regulation of the l-arabinose operon in Escherichia coli with indoleacetic acid and other indole derivatives. Proc. Natl. Acad. Sci. USA 77:1768–1772.
77. Kolb, A., S. Busby, H. Buc, S. Garges, and S. Adhya. 1993. Transcriptional regulation by cAMP and its receptor protein. Annu. Rev. Biochem. 62:749–795.
78. Kolter, R., D. A. Siegele, and A. Tormo. 1993. The stationary phase of the bacterial life cycle. Annu. Rev. Microbiol. 47:855–874.
79. Kornberg, H. L., and C. M. Elvin. 1987. Location and function of fruC, a gene involved in the regulation of fructose utilization by Escherichia coli. J. Gen. Microbiol. 133:341–346.
80. Kwakman, J. H. J. M., and P. W. Postma. 1994. Glucose kinase has a regulatory role in carbon catabolite repression in Streptomyces coelicolor. J. Bacteriol. 176:2694–2698.
81. Lange, R., M. Barth, and R. Hengge-Aronis. 1993. Complex transcriptional control of the σS-dependent stationary-phase-induced and osmotically regulated osmY (csi-5) gene suggests novel roles for Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex, and integration host factor in the stationary-phase response of Escherichia coli. J. Bacteriol. 175:7910–7917.
82. Lange, R., and R. Hengge-Aronis. 1991. Identification of a central regulator of stationary-phase gene expression in Escherichia coli. Mol. Microbiol. 5:49–59.
83. Lee, J. H., and W. J. Dobrogosz. 1983. Effects of aerobic and anaerobic shock on catabolite repression in cyclic AMP suppressor mutants of Escherichia coli. J. Bacteriol. 154:992–994.
84. Leonard, J. E., C. Lee, A. Apperson, S. S. Dills, and M. H. Saier, Jr. 1981. The role of membranes in the transport of small molecules, p. 1–52. In B. K. Ghosh (ed.), Organization of Prokaryotic Cell Membranes, vol. 1. CRC Press, Boca Raton, Fla.
85. Liao, D.-I., G. Kapadia, P. Reddy, M. H. Saier, Jr., J. Reizer, and O. Herzberg. 1991. Structure of the IIA domain of the glucose permease of Bacillus subtilis at 2.2 Å resolution. Biochemistry 30:9583–9594.
86. Liu-Johnson, H.-N., M. R. Gartenberg, and D. M. Crothers. 1986. The DNA binding domain and bending angle of E. coli CAP protein. Cell 47:995–1005.
87. Lobell, R, B., and R. F. Schleif. 1991. AraC DNA looping—orientation and distance-dependent loop breaking by the cyclic AMP receptor protein. J. Mol. Biol. 218:45–54.
88. Loewen, P. C., I. von Ossowski, J. Switala, and M. R. Mulvey. 1993. KatF (σS) synthesis in Escherichia coli is subject to posttranscriptional regulation. J. Bacteriol. 175:2150–2153.
89. Lomovskaya, O. L., J. P. Kidwell, and A. Matin. 1994. Characterization of the σ38-dependent expression of a core Escherichia coli starvation gene, pexB. J. Bacteriol. 176:3928–3925.
90. Lukat, G. S., and J. B. Stock. 1993. Response regulation in bacterial chemotaxis. J. Cell. Biochem. 51:41–46.
91. Mach, H., M. Hecker, and F. Mach. 1988. Physiological studies on cAMP synthesis in Bacillus subtilis. FEMS Microbiol. Lett. 52:189–192.
92. Magasanik, B. 1970. Glucose effects: inducer exclusion and repression, p. 189–219. In J. R. Beckwith and D. Zipser (ed.), The Lactose Operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
93. Magasanik, B., and F. C. Neidhardt. 1987. Regulation of carbon and nitrogen utilization, p. 1318–1325. In F. C. Neidhardt, J. L. Ingraham, B. Magasanik, K. B. Low, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D.C.
94. Makman, R. S., and E. W. Sutherland. 1965. Adenosine 3',5'-phosphate in Escherichia coli. J. Biol. Chem. 240:1309–1314.
95. Matin, A. 1990. Molecular analysis of the starvation stress in Escherichia coli. FEMS Microbiol. Ecol. 74:185–195.
96. Matin, A. 1991. The molecular basis of carbon-starvation-induced general resistance in Escherichia coli. Mol. Microbiol. 5:3–10.
97. Matin, A., E. A. Auger, P. H. Blum, and J. E. Schultz. 1989. Genetic basis of starvation survival in nondifferentiating bacteria. Annu. Rev. Microbiol. 43:293–316.
98. McCann, M. P., C. D. Fraley, and A. Matin. 1993. The putative σ factor KatF is regulated posttranscriptionally during carbon starvation. J. Bacteriol. 175:2143–2149.
99. McCann, M. P., J. P. Kidwell, and A. Matin. 1991. The putative σ factor KatF has a central role in development of starvation-mediated general resistance in Escherichia coli. J. Bacteriol. 173:4188–4194.
100. Merrick, M. J., and J. R. Coppard. 1989. Mutations in genes downstream of the rpoN gene (encoding σ54) of Klebsiella pneumoniae affect expression from σ54-dependent promoters. Mol. Microbiol. 3:1765–1775.
101. Metzger, S., G. Schreiber, E. Aizenman, M. Cashel, and G. Glaser. 1989. Characterization of the relA1 mutation and a comparison of relA1 with new relA null alleles in Escherichia coli. J. Biol. Chem. 264:21146–21152.
102. Møllegaard, N. E., P. B. Rasmussen, P. Valentin-Hansen, and P. E. Nielsen. 1993. Characterization of promoter recognition complexes formed by CRP and CytR for repression and by CRP and RNA polymerase for activation of transcription on the Escherichia coli deoP2 promoter. J. Biol. Chem. 268:17471–17477.
103. Okamoto, K., and M. Freundlich. 1986. Mechanism for autogenous control of the crp operon: transcriptional inhibition by a divergent RNA transcript. Proc. Natl. Acad. Sci. USA 83:5000–5004.
104. Okamoto, K., S. Hara, R, Bhasin, and M. Freundlich. 1988. Evidence in vivo for autogenous control of the cyclic AMP receptor protein (crp) in Escherichia coli by divergent RNA. J. Bacteriol. 170:5076–5079.
105. Pao, G. M., and M. H. Saier, Jr. 1995. Response regulators of bacterial signal transduction systems: selective domain shuffling during evolution. J. Mol. Evol. 40:136–154.
106. Parkinson, J. S. 1993. Signal transduction schemes of bacteria. Cell 73:857–871.
107. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71–112.
108. Pastan, I., and S. Adhya. 1976. Cyclic adenosine 5'-monophosphate in Escherichia coli. Bacteriol. Rev. 40:527–551.
109. Pastan, I., and R. L. Perlman. 1969. Repression of β-galactosidase synthesis by glucose in phosphotransferase mutants of Escherichia coli. Repression in the absence of glucose phosphorylation. J. Biol. Chem. 244:5836–5842.
110. Pedersen, H., L. Søgaard-Andersen, B. Holst, and P. Valentin-Hansen. 1991. Heterologous cooperativity in Escherichia coli. The CytR repressor both contacts DNA and the cAMP receptor protein when binding to the deoP2. J. Biol. Chem. 266:17804–17808.
111. Pelton, J. G., D. A. Torchia, N. D. Meadow, C.-Y. Wong, and S. Roseman. 1991. Secondary structure of the phosphocarrier protein IIIGlc, a signal-transducing protein from Escherichia coli, determined by heteronuclear three-dimensional NMR spectroscopy. Proc. Natl. Acad. Sci. USA 88:3479–3483.
112. Peterkofsky, A., and C. Gazdar. 1975. Interaction of Enzyme I of the phosphoenolpyruvate:sugar phosphotransferase system with adenylate cyclase of Escherichia coli. Proc. Natl. Acad. Sci. USA 72:2920–2924.
113. Peterkofsky, A., A. Reizer, J. Reizer, N. Gollop, P.-P. Zhu, and N. Amin. 1993. Bacterial adenylyl cyclases. Prog. Nucleic Acid Res. Mol. Biol. 44:31–65.
114. Pinkney, M., and J. G. Hoggett. 1988. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase. Biochem. J. 250:897–902.
115. Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57:543–594.
116. Powell, B. S., D. L. Court, T. Inada, Y. Nakamura, V. Michotey, X. Cui, A. Reizer, M. H. Saier, Jr., and J. Reizer. 1995. Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an era ts mutant. J. Biol. Chem. 270:4822–4839.
117. Raibaud, O., D. Vidal-Ingigliardi, and E. Richet. 1989. A complex nucleoprotein structure involved in activation of transcription of two divergent Escherichia coli promoters. J. Mol. Biol. 205:471–485.
118. Ramseier, T. M., S. Bledig, V. Michotey, R. Feghali, and M. H. Saier, Jr. 1995. The global regulatory protein, FruR, modulates the direction of carbon flow in Escherichia coli. Mol. Microbiol. 16:1157–1169.
119. Ramseier, T. M., M. Inui, and M. H. Saier, Jr. 1995. CarRS of Azospirillum brasilense is homologous to a large family of aldehyde dehydrogenases rather than to two-component regulators. Res. Microbiol. 146:425–429.
120. Ramseier, T. M., D. Nègre, J.-C. Cortay, M. Scarabel, A. J. Cozzone, and M. H. Saier, Jr. 1993. In vitro binding of the pleiotropic transcriptional regulatory protein, FruR, to the fru, pps, ace, pts and icd operons of Escherichia coli and Salmonella typhimurium. J. Mol. Biol. 234:28–44.
121. Reddy, P., N. Meadow, S. Roseman, and A. Peterkofsky. 1985. Reconstitution of regulatory properties of adenylate cyclase in Escherichia coli extracts. Proc. Natl. Acad. Sci. USA 82:8300–8304.
122. Reizer, J., J. Deutscher, and M. H. Saier, Jr. 1989. Metabolite-sensitive, ATP-dependent, protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system in Gram-positive bacteria. Biochemie 71:989–996.
123. Reizer, J., A. Reizer, H. L. Kornberg, and M. H. Saier, Jr. 1994. Sequence of the fruB gene of Escherichia coli encoding the diphosphoryl transfer protein (DTP) of the phosphoenolpyruvate:sugar phosphotransferase system. FEMS Microbiol. Lett. 118:159–162.
124. Reizer, J., A. Reizer, and M. H. Saier, Jr. 1994. A functional superfamily of sodium:solute symporters. Biochim. Biophys. Acta 1197:133–166.
125. Reizer, J., A. Reizer, M. H. Saier, Jr., and G. R. Jacobson. 1992. A proposed link between nitrogen and carbon metabolism involving protein phosphorylation in bacteria. Protein Sci. 1:722–726.
126. Reizer, J., S. L. Sutrina, M. H. Saier, Jr., G. C. Stewart, A. Peterkofsky, and P. Reddy. 1989. Mechanistic and physiological consequences of HPr(ser) phosphorylation on the activities of the phosphoenolpyruvate:sugar phosphotransferase system in Gram-positive bacteria: studies with site-specific mutants of HPr. EMBO J. 8:2111–2120.
127. Ren, Y. L., S. Garges, S. Adhya, and J. S. Krakow. 1988. Cooperative DNA binding of heterologous proteins: evidence for contact between the cyclic AMP receptor protein and RNA polymerase. Proc. Natl. Acad. Sci. USA 85:4138–4142.
128. Rephaeli, A. W., and M. H. Saier, Jr. 1976. Effects of crp mutations on adenosine 3',5'-monophosphate metabolism in Salmonella typhimurium. J. Bacteriol. 127:120–127.
129. Reznikoff, W. S. 1992. Catabolite gene activator protein activation of lac transcription. J. Bacteriol. 174:655–658.
130. Richet, E., D. Vidal-Ingigliardi, and O. Raibaud. 1991. A new mechanism for coactivation of transcription initiation. Repositioning of an activator triggered by the binding of a 2nd activator. Cell 66:1185–1195.
131. Roy, A., P. Glaser, and A. Danchin. 1988. Aspects of the regulation of adenylate cyclase synthesis by Escherichia coli K-12. J. Gen. Microbiol. 134:359–363.
132. Roy, A., C. Haziza, and A. Danchin. 1983. Regulation of adenylate cyclase synthesis in Escherichia coli: nucleotide sequence of the control region. EMBO J. 2:791–797.
132a. Ryu, S., T. M. Ramseier, V. Michotey, M. H. Saier, Jr., and S. Garges. 1995. Effect of the FruR regulator on transcription of the pts operon in Escherichia coli. J. Biol. Chem. 270:2489–2496.
133. Saier, M. H., Jr. 1979. The role of the cell surface in regulating the internal environment, p. 167–227. In I. C. Gunsalus and R. Y. Stanier (ed.), The Bacteria, vol. 7. Academic Press, New York.
134. Saier, M. H., Jr. 1989. Protein phosphorylation and allosteric control of inducer exclusion and catabolite repression by the bacterial phosphoenolpyruvate:sugar phosphotransferase system. Microbiol. Rev. 53:109–120.
135. Saier, M. H., Jr. 1989. Involvement of the bacterial phosphotransferase system in diverse mechanisms of transcriptional regulation. Res. Microbiol. 140:349–354.
136. Saier, M. H., Jr. 1991. A multiplicity of potential carbon catabolite repression mechanisms in prokaryotic and eukaryotic microorganisms. New Biol. 3:1137–1147.
137. Saier, M. H., Jr. 1993. Introduction: protein phosphorylation and signal transduction in bacteria. J. Cell. Biochem. 51:1–6.
138. Saier, M. H., Jr. 1993. Regulatory interactions involving the proteins of the phosphotransferase system in enteric bacteria. J. Cell. Biochem. 51:62–68.
139. Saier, M. H., Jr. 1994. Bacterial sensor kinase-response regulator systems: an introduction. Res. Microbiol. 145:349–355.
140. Saier, M. H., Jr. (ed.). 1994. 12th Forum in Microbiology: bacterial sensor kinase-response regulator systems. Res. Microbiol. 145:356–362.
141. Saier, M. H., Jr., S. Chauvaux, J. Deutscher, J. Reizer, and J.-J. Ye. 1995. Protein phosphorylation and the regulation of carbon metabolism: comparisons in Gram-negative versus Gram-positive bacteria. Trends Biochem. Sci. 20:267–271.
142. Saier, M. H., Jr., and A. M. Chin. 1990. Energetics of the bacterial phosphotransferase system in sugar transport and the regulation of carbon metabolism, p. 273–299. In T. A. Krulwich (ed.), Bacterial Energetics. Academic Press, New York.
143. Saier, M. H., Jr., and B. U. Feucht. 1975. Coordinate regulation of adenylate cyclase and carbohydrate permeases by the phosphoenolpyruvate:sugar phosphotransferase system in Salmonella typhimurium. J. Biol. Chem. 250:7078–7080.
144. Saier, M. H., Jr., B. U. Feucht, and M. T. McCaman. 1975. Regulation of intracellular adenosine cyclic 3':5'-monophosphate levels in Escherichia coli and Salmonella typhimurium. J. Biol. Chem. 250:7593–7601.
145. Saier, M. H., Jr., and J. Reizer. 1992. Proposed uniform nomenclature for the proteins and protein domains of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. J. Bacteriol. 174:1433–1438.
146. Saier, M. H., Jr., R. D. Simoni, and S. Roseman. 1970. The physiological behavior of Enzyme I and heat-stable protein mutants of a bacterial phosphotransferase system. J. Biol. Chem. 245:5870–5873.
147. Saier, M. H., Jr., H. Straud, L. S. Massman, J. J. Judice, M. J. Newman, and B. U. Feucht. 1978. Permease-specific mutations in Salmonella typhimurium and Escherichia coli that release the glycerol, maltose, melibiose, and lactose transport systems from regulation by the phosphoenolpyruvate:sugar phosphotransferase system. J. Bacteriol. 133:1358–1367.
148. Saier, M. H., Jr., L.-F. Wu, and J. Reizer. 1990. Regulation of bacterial physiological processes by three evolutionarily distinct types of protein phosphorylating systems. Trends Biochem. Sci. 178:391–395.
149. Schellhorn, H. E., and V. L. Stones. 1992. Regulation of katF and katE in Escherichia coli K-12 by weak acids. J. Bacteriol. 174:4769–4776.
150. Shaibe, E., E. Metzer, and Y. S. Halpern. 1985. Control of utilization of l-arginine, l-ornithine, agmatine, and putrescine as nitrogen sources in Escherichia coli K-12. J. Bacteriol. 163:938–942.
151. Silverstone, A. E., and B. Magasanik. 1972. Polycistronic effects of catabolite repression on the lac operon. J. Bacteriol. 112:1184–1192.
152. Sogaard-Andersen, L., A. S. Mironov, H. Pedersen, V. V. Sukhodelets, and P. Valentin-Hansen. 1991. Single amino acid substitutions in the cAMP receptor protein specifically abolish regulation by the CytR repressor in Escherichia coli. Proc. Natl. Acad. Sci. USA 88:4921–4925.
153. Sogaard-Andersen, L., H. Pedersen, B. Holst, and P. Valentin-Hansen. 1991. A novel function of the cAMP-CRP complex in Escherichia coli. cAMP-CRP functions as an adaptor for the CytR repressor in the deo operon. Mol. Microbiol. 5:969–975.
154. Spector, M. P., Z. Aliabadi, T. Gonzalez, and J. W. Foster. 1986. Global control in Salmonella typhimurium: two-dimensional electrophoretic analysis of starvation, anaerobiosis, and heat shock-inducible proteins. J. Bacteriol. 168:420–424.
155. Spector, M. P., Y. K. Park, S. Turgari, T. Gonzalez, and J. W. Foster. 1988. Identification and characterization of starvation-regulated genetic loci in Salmonella typhimurium by using Mu d-directed lacZ operon fusions. J. Bacteriol. 170:345–357.
156. Stender, W. 1980. Cyclic adenosine 3':5'-monophosphate receptor protein: interaction with E. coli RNA polymerase. Biochem. Biophys. Res. Commun. 96:320–325.
157. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53:450–490.
158. Stone, M. J., W. J. Fairbrother, A. G. Palmer III, J. Reizer, M. H. Saier, Jr., and P. E. Wright. 1992. The backbone dynamics of the Bacillus subtilis glucose permease IIA domain determined from 15N NMR relaxation measurements. Biochemistry 31:4394–4406.
159. Straney, D. C., S. B. Straney, and D. M. Crothers. 1989. Synergy between Escherichia coli CAP protein and RNA polymerase in the lac promoter open complex. J. Mol. Biol. 206:41–57.
160. Sutrina, S. L., A. M. Chin, F. Esch, and M. H. Saier, Jr. 1988. Purification and characterization of the fructose-inducible HPr-like protein, FPr, and the fructose-specific Enzyme III of the phosphoenolpyruvate:sugar phosphotransferase system of Salmonella typhimurium. J. Biol. Chem. 263:5061–5069.
161. Titgemeyer, F., R. E. Mason, and M. H. Saier, Jr. 1994. Regulation of the raffinose permease of Escherichia coli by the glucose-specific enzyme IIA of the phosphoenolpyruvate:sugar phosphotransferase system. J. Bacteriol. 176:543–546.
162. Touati, E., E. Dassa, J. Dassa, P. L. Boquet, and D. Touati. 1991. Are appR and katF the same Escherichia coli gene encoding a new sigma transcription initiation factor? Res. Microbiol. 142:29–36.
163. Tyler, B., and B. Magasanik. 1970. Physiological basis of transient repression of catabolic enzymes in Escherichia/ coli. J. Bacteriol. 102:411–422.
164. Ullmann, A., and A. Danchin. 1983. Role of cyclic AMP in bacteria. Adv. Cyclic Nucleotide Res. 15:1–53.
165. Ullmann, A., F. Tillier, and J. Monod. 1976. Catabolite modulator factor: a possible mediator of catabolite repression in bacteria. Proc. Natl. Acad. Sci. USA 73:3476–3479.
166. Ushida, C., and H. Aiba. 1990. Helical phase dependent action of CRP: effect of the distance between the CRP site and the –35 region on promoter activity. Nucleic Acids Res. 18:6325–6330.
167. Utsumi, R., M. Kawamukai, H. Aiba, M. Himeno, and T. Komano. 1986. Expression of the adenylate cyclase gene during cell elongation in Escherichia coli K-12. J. Bacteriol. 168:1408–1414.
168. Vartak, N. B., J. Reizer, A. Reizer, J. T. Gripp, E. A. Groisman, L.-F. Wu, J. M. Tomich, and M. H. Saier, Jr. 1991. Sequence and evolution of the FruR protein of Salmonella typhimurium: a pleiotropic transcriptional regulatory protein possessing both activator and repressor functions which is homologous to periplasmic ribose-binding proteins. Res. Microbiol. 142:951–963.
169. Vogler, A. P., and J. W. Lengeler. 1987. Indirect role of adenylate cyclase and cyclic AMP in chemotaxis to phosphotransferase system carbohydrates in Escherichia coli K-12. J. Bacteriol. 169:593–599.
170. Wanner, B. L. 1990. Phosphorus assimilation and its control of gene expression in Escherichia coli, p. 152–163. In G. Hauska and R. Thauer (ed.), The Molecular Basis of Bacterial Metabolism. Springer-Verlag, Heidelberg.
171. Webster, C., K. Gaston, and S. Busby. 1988. Transcription from the Escherichia coli melR promoter is dependent on the cyclic AMP receptor protein. Gene 68:297–305.
172. Weickert, M. J., and S. Adhya. 1992. A family of bacterial regulators homologous to Gal and Lac repressors. J. Biol. Chem. 267:15869–15874.
173. Wilson, T. H., P. L. Yunker, and C. L. Hansen. 1990. Lactose transport mutants of Escherichia coli resistant to inhibition by the phosphotransferase system. Biochim. Biophys. Acta 1029:113–116.
174. Wittekind, M., J. Reizer, J. Deutscher, M. H. Saier, Jr., and R. E. Klevitt. 1989. Common structural changes accompany the functional inactivation of HPr by seryl phosphorylation or by serine to aspartate substitution. Biochemistry 28:9908–9912.
175. Wu, L.-F., A. Reizer, J. Reizer, B. Cai, J. M. Tomich, and M. H. Saier, Jr. 1991. Nucleotide sequence of the Rhodobacter capsulatus fruK gene, which encodes fructose-1-phosphate kinase: evidence for a kinase superfamily including both phosphofructokinases of Escherichia coli. J. Bacteriol. 173:3117–3127.
176. Wu, L.-F., and M. H. Saier, Jr. 1990. Nucleotide sequence of the fruA gene, encoding the fructose permease of the Rhodobacter capsulatus phosphotransferase system, and analyses of the deduced protein sequence. J. Bacteriol. 172:7167–7178.
177. Yang, H.-L., G. Zubay, E. Urm, G. Reiness, and M. Cashel. 1974. Effects of guanosine tetraphosphate, guanosine pentaphosphate, and β-γ methylenyl-guanosine pentaphosphate on gene expression of Escherichia coli in vitro. Proc. Natl. Acad. Sci. USA 71:63–67.
178. Ye, J.-J., J. W. Neal, X. Cui, J. Reizer, and M. H. Saier, Jr. 1994. Regulation of the glucose:H+ symporter by metabolite-activated ATP-dependent phosphorylation of HPr in Lactobacillus brevis. J. Bacteriol. 176:3484–3492.
179. Ye, J.-J., J. Reizer, X. Cui, and M. H. Saier, Jr. 1994. ATP-dependent phosphorylation of serine-46 in the phosphocarrier protein HPr regulates lactose/H+ symport in Lactobacillus brevis. Proc. Natl. Acad. Sci. USA 91:3102–3106.
180. Ye, J.-J., J. Reizer, X. Cui, and M. H. Saier, Jr. 1994. Inhibition of the phosphoenolpyruvate:lactose phosphotransferase system and activation of a cytoplasmic sugar-phosphate phosphatase in Lactococcus lactis by ATP-dependent metabolite-activated phosphorylation of serine 46 in the phosphocarrier protein HPr. J. Biol. Chem. 269:11837–11844.
181. Ye, J.-J., J. Reizer, and M. H. Saier, Jr. 1994. Regulation of 2-deoxyglucose accumulation in Lactococcus lactis vesicles by metabolite-activated, ATP-dependent phosphorylation of serine-46 in HPr of the phosphotransferase system. Microbiology 140:3421–3429.
182. Ye, J.-J., and M. H. Saier, Jr. 1995. Cooperative binding of lactose and HPr(ser-P) to the lactose:H+ permease of Lactobacillus brevis. Proc. Natl. Acad. Sci. USA 92:417–421.
183. Ye, J.-J., and M. H. Saier, Jr. 1995. Allosteric regulation of the glucose:H+ symporter of Lactobacillus brevis: cooperative binding of glucose and HPr(ser-P). J. Bacteriol. 177:1900–1902.
184. Zeng, G. Q., H. De Reuse, and A. Danchin. 1992. Mutational analysis of the Enzyme IIIglc of the phosphoenolpyruvate phosphotransferase system in Escherichia coli. Res. Microbiol. 143:251–261.
Chapter85
