The SOS Regulatory Network

TOC

doi: 10.1128/ecosal.5.4.3

LYLE A. SIMMONS,^† JAMES J. FOTI,^† SUSAN E. COHEN, AND GRAHAM C. WALKER*

[SECTION EDITOR: JOHN FOSTER]

Posted July 25, 2008

Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139

*Corresponding author. Mailing address: Department of Biology, Building 68-633, MIT, Cambridge, MA 02139. Phone: (617) 253-3745, Fax: (617) 253-2643, E-mail: This e-mail address is being protected from spambots. You need JavaScript enabled to view it

†These authors contributed equally to this work.

All organisms possess a diverse set of genetic programs that are used to alter cellular physiology in response to environmental cues. The gram-negative bacterium Escherichia coli mounts what is known as the "SOS response" following DNA damage, replication fork arrest, and a myriad of other environmental stresses. For over 50 years, E. coli has served as the paradigm for our understanding of the transcriptional and physiological changes that occur following DNA damage (400). In this chapter, we summarize the current view of the SOS response and discuss how this genetic circuit is regulated. In addition to examining the E. coli SOS response, we also include a discussion of the SOS regulatory networks in other bacteria to provide a broader perspective on how prokaryotes respond to DNA damage.

OVERVIEW OF THE SOS RESPONSE

In E. coli, DNA damage and replication perturbations results in the SOS response, a genetic program that transcriptionally up-regulates over 50 unlinked genes (Table 1). The term "SOS" was coined by Miroslav Radman in 1974 when he postulated the existence of the pathway on the basis of a set of physiological responses induced by DNA damage whose regulation was controlled by the lexA⁺ and recA⁺ gene products (300). Radman defined "SOS" as a distress signal used to sense DNA damage or replication fork blockages.

Table 1SOS-regulated genes

Since the original hypothesis, the distress signal has been shown to be the accumulation of single-stranded DNA (ssDNA). As described in greater detail below, LexA protein is a negative regulator of the SOS response by acting as a transcriptional repressor. RecA is a positive regulator of this response, and the interaction between LexA and RecA polymerized on ssDNA is required to relieve LexA-dependent transcriptional repression of SOS genes. Of the >50 unlinked genes that constitute the SOS response, several are directly involved in DNA repair, DNA damage tolerance, or induction of a DNA damage checkpoint by blocking cell division.

The SOS response is wired to allow for high-fidelity repair to take place before giving way to a more mutagenic mode allowing for cell survival. When the SOS response is induced the first set of genes to be expressed are gene products involved in high-fidelity DNA repair. Further into SOS induction, sulA gene expression is induced and this protein causes a DNA damage checkpoint by inhibiting cell division. The SulA-dependent checkpoint allows cells time to repair their DNA before damaged chromosomes are segregated into daughter cells. Late in the SOS response, umuC and umuD genes are expressed and these gene products assemble into a translesion DNA polymerase that has mutagenic potential, as high-fidelity repair gives way to lower-fidelity damage tolerance. This lower-fidelity DNA damage tolerance pathway is so named because the damage is not removed, but instead tolerated.

Below, we review and discuss the experiments leading toward our current understanding of the SOS response. We also provide a comprehensive summary (Table 1) of all the genes known to be LexA regulated, bringing the total number to 57. Moreover, we include a table of genes that are potentially LexA regulated but have yet to be verified (Table 2).

Table 2Potential SOS-regulated genes

THE GENETICS OF SOS REGULATION

The SOS response is a genetic circuit that is regulated by the LexA and RecA proteins (4, 46, 47, 56, 91, 194, 211, 212, 213, 214) (Fig. 1). LexA is a transcriptional repressor that occupies its cognate operator binding site (SOS box) as a homodimer, thereby blocking RNA polymerase (RNAP) binding and transcription (1, 33, 34, 161, 218). LexA has a cryptic autocleavage activity that is activated when LexA interacts with a RecA/ssDNA nucleoprotein filament. Expression of recA⁺ and lexA⁺ gene products are regulated in an SOS-dependent fashion and RecA is rather abundant in the noninduced state (331). Considerable in vitro and in vivo evidence has shown that when bacterial DNA is damaged, ssDNA is generated (see "Mechanisms generating ssDNA," below). RecA binds ssDNA forming a nucleoprotein filament (104, 147, 347, 419). Interaction between the RecA/ssDNA nucleoprotein filament and LexA activates LexA autodigestion, thereby inactivating LexA as a repressor and leading to the transcription of LexA repressed genes (46, 47, 91, 162, 215). Below, we review the sophisticated network of proteins that influence the magnitude and timing of SOS induction.

Fig. 1A model for SOS induction. (A) In the uninduced state, replication proceeds unperturbed and the limited amount of ssDNA present at the replication fork is not available for RecA binding. Transcription of lexA⁺ (green), recA⁺(purple), sulA⁺ (orange), and other SOS-regulated genes is largely repressed. After DNA damage (red circle), RecA binds to the increasing amount of ssDNA in the cell creating the RecA/ssDNA nucleoprotein filament (purple and yellow). The RecA/ssDNA nucleoprotein filament acts as a coprotease to cleave LexA, resulting in the expression of the SOS regulon. As the gene products of the SOS regulon repair the DNA damage, the cell will return to the uninduced state as normal replication proceeds and the switch is reset. (B) Generation and stabilization of a RecA nucleoprotein filament is regulated by a number of cellular factors. RecBCD and RecFOR can act at a stalled replication fork (Left) to generate ssDNA for RecA binding. RecA binding and filamentation can be aided by RecFOR or prevented by RecX (Center). Once formed, the RecA filament can be stabilized by DinI binding (Right).

Source: Adapted from an illustration by Patricia J. Wynne and Cell (217) with permission (http://www.sciencedirect.com).

The recA⁺ Gene Product

RecA, a key player in DNA repair, is required for homologous recombination, SOS induction, and translesion synthesis (TLS). Many of the original recA mutant allele studies suggested that RecA is a positive regulator of SOS because these alleles were defective in recombination and SOS induction (257, 408). It is now known that RecA is required to facilitate LexA autocleavage and thus is a coprotease. The role of RecA in SOS induction was genetically defined when alleles of recA were isolated that result in constitutive SOS induction in the absence of exogenous DNA damage (192, 409). These coprotease constitutive recA alleles [recA(Cpt^c)] induce SOS during normal growth conditions, or, in the case of recA441, a temperature shift to 42^oC to induce SOS (61, 409). Biochemical examination of the proteins encoded by recA441 and recA730 showed that these proteins displayed an exceptionally high affinity for ssDNA and are able to displace single-strand binding protein (SSB), an activity that is not observed with wild-type RecA protein (192, 201). It is hypothesized that recA coprotease constitutive mutants are able to compete with SSB for the low levels of ssDNA present at the replication fork during normal replication. It should be noted that RecA803 is capable of SSB displacement under specific in vitro conditions, but does not result in constitutive SOS in vivo (201, 229, 230). These results can be explained by the idea that more than ssDNA binding is important for SOS induction or by the observation that RecA803 displaces SSB in vitro only under certain conditions that are not mimicked in vivo (201, 229, 230). Taken together, RecA binding to ssDNA is a critical step toward SOS induction, but more than ssDNA binding is involved, including proper protein-protein interaction between RecA/ssDNA and LexA.

Other classes of recA point mutants that interfere with the ability of RecA to regulate SOS have also been described (90). For example, RecA430 is proficient for homologous recombination, but inefficient as a LexA coprotease (90, 244). To date, several hundred recA alleles have been isolated and examined for repair and SOS defects (for a review, see reference 239).

The lexA⁺ Gene Product

Alleles of the lexA gene have been identified that are defective in SOS induction [lexA(Ind⁻)] (146, 210, 258), as well as alleles that encode variants of the LexA protein that fail to act as a repressor, thereby resulting in constitutive SOS induction [lexA(Def)] (55). The lexA(Ind⁻) class are dominant alleles so named for their lack of SOS induction. These alleles encode mutations that prevent autocleavage by altering the LexA cleavage site, or by altering the interaction between LexA and the RecA/ssDNA nucleoprotein filament. lexA(Def) alleles are lethal in an otherwise wild-type E. coli genetic background, a factor that complicated their isolation (259). LexA protein represses sulA⁺ (also called sfiA⁺) (70), which inhibits cell division by blocking FtsZ ring assembly (35). Therefore, lexA(Def) mutations must be propagated in a sulA-deficient background to prevent a SulA-dependent block to cell division. The lexA(Def) mutation alone results in excessive SulA-dependent filamentation and cell death. SulA homologs are not as widespread as LexA homologs. For example, in Bacillus subtilis, SOS-dependent cell filamentation is mediated by YneA a protein that interferes with FtsZ ring polymerization, but does not share sequence similarity to E. coli SulA (179).

These genetic studies established that RecA/ssDNA nucleoprotein filament formation activates the cryptic protease activity of LexA resulting in cleavage, and derepression of LexA-repressed genes. Although recA⁺ and lexA⁺ are the two key regulatory elements of the SOS regulon, a growing list of proteins are involved in modulating SOS induction through positive or negative regulation of RecA/ssDNA nucleoprotein filament formation, LexA cleavage, or both (for an overview of the SOS response, see Fig. 1).

LexA Binds to SOS Boxes and Inhibits Transcription

In addition to genetic studies, which indicated that LexA is a negative regulator of SOS, in vitro studies have demonstrated that purified LexA protein can bind to operator sites resulting in inhibition of transcription (45, 47, 120, 218, 325, 326, 335). Comparisons of these sequences led to the discovery of a LexA binding site known as an SOS box, with a consensus sequence of TACTGTATATATATACAGTA in E. coli (120). All known SOS operators contain a 5' CTGT consensus sequence with some preference for alternating (AT)₄ sequences. Within the 5' CTGT consensus sequence, the central T and G bases are absolutely required for LexA binding. Mutations that result in an operator-constitutive phenotype have also been isolated, causing increased expression of the affected LexA-controlled gene (69, 241, 402, 403). Diversity within SOS boxes contributes to temporal activation of gene expression as well as final induced levels. Induction ranges from about 100-fold in the case of sulA⁺, one of the most tightly repressed SOS genes, to 4- to 5-fold in the case of uvrA⁺, uvrB⁺ and uvrD⁺, ruvAB⁺, and lexA⁺ (335). Many parameters may be attributed to the differences in expression besides operator strength, such as location of operator relative to the promoter, promoter strength, and existence of additional, constitutive promoters. SOS boxes have been mapped to many locations, including overlapping with the −35 promoter region (uvrA⁺), between the −10 and −35 regions (recA⁺, uvrB⁺), overlapping with the −10 region (sulA⁺, umuDC⁺), as well as downstream of the transcriptional start site (uvrD⁺, cea⁺, and caa⁺) (120, 335), thus allowing for a multivariable coordination of expression throughout the SOS response (for SOS box locations throughout the genome see Tables 1 and 2).

In vitro studies have shown that LexA binds to DNA as a dimer. Dimerization has proven critical for the repression of the SOS response. LexA consists of two structurally defined domains joined by a flexible hinge region (227). The N-terminal domain, amino acids 1 to 84, specifically recognizes SOS boxes, although at a lower affinity than the intact protein (34, 161, 162, 186). The C-terminal domain is necessary for dimerization, with both intact and C-terminal fragments forming dimers in solution, with a dissociation constant <20 pM (253, 334). LexA cleavage of the Ala⁸⁴–Gly⁸⁵ bond located within the hinge region during SOS induction separates the two domains, inactivating LexA as a transcriptional repressor. This cleavage not only regulates LexA activity, lowering LexA’s affinity for DNA, but also LexA’s stability by exposing residues that target LexA for degradation by ClpXP protease (268) (see "Posttranslational regulation of SOS-induced proteins," below).

VARIOUS MECHANISMS OF SOS INDUCTION

Extensive analyses have shown that several seemingly unrelated stresses result in DNA lesions that impede replication, ultimately resulting in SOS induction. Experimental evidence suggests that these lesions are processed to ssDNA leading to SOS induction through RecA/ssDNA nucleoprotein filament-mediated cleavage of the transcriptional repressor LexA. The mechanisms ultimately leading to the formation of ssDNA are not well understood for all the SOS-inducing stresses. Furthermore, it is becoming more apparent that many bacterial species utilize the SOS response to promote cell survival during a variety of stressful environmental conditions.

DNA-Damaging Agents

A myriad of DNA-altering or -damaging agents have been shown to induce the SOS response in E. coli, including nalidixic acid, 3'-azido-3'-deoxythymidine (AZT), nitrofurazone, mitomycin C, benzo[a]pyrene diol epoxide, hydrogen peroxide, and 4-nitroquinoline, among many others (20, 131, 140, 141, 164, 270, 295, 339, 361). The lesions created by these agents (altered nucleotides, ssDNA nicks, gaps, dsDNA breaks, etc.) can impede DNA replication and must be removed by DNA repair mechanisms or tolerated by using DNA damage tolerance pathways, which are integrated into the SOS circuit. However, more than 1,000 E. coli genes are regulated in response to mitomycin C exposure, suggesting that SOS-induced genes may not be sufficient for recovery after treatment (184).

High Pressure

Hydrostatic pressure was recently shown to induce a recA⁺, recB⁺, and lexA⁺-dependent SOS response in E. coli (3). The requirements for RecB suggests that ssDNA is formed through the processing of a double-strand break intermediate. Subsequent experiments revealed that an endogenous restriction endonuclease Mrr generates a double-strand break after high-pressure stress (2). The mechanism responsible for high-pressure stress activation of Mrr is unknown, but represents an example of self-targeted DNA restriction, a rather unusual method to manage stress. Although E. coli is not naturally subjected to high-pressure environments, foods are often subjected to a combination of bacterial stresses, such as high pressure, to inactivate food-borne pathogens such as E. coli O157:H7, Salmonella, and Listeria monocytogenes (7, 66, 129, 261, 282, 412).

Antibiotics

Cell wall stress induced by treatment with β-lactam antibiotics or by compromising penicillin-binding protein 3 (ftsI⁺) activity induces the DpiBA two-component signal transduction system in E. coli (246, 247). DpiA binds A+T-rich sequences, thereby preventing DnaA and DnaB activity at the origin of replication resulting in SOS induction (246). Induction of SOS leads to the transcriptional up-regulation of the sulA⁺ gene. SulA binds to FtsZ, thereby blocking FtsZ ring formation, which temporarily prevents cell division and provides protection against cell death (260, 369, 401). Many recent studies suggest that the pathogens Staphylococcus aureus and Pseudomonas aeruginosa utilize the SOS response as a mechanism to promote antibiotic resistance (37, 67, 68, 232). For example, SOS induction by antibiotics not only results in increased TLS-dependent mutagenesis, but can also lead to transfer of pathogenicity islands (232, 374).

Starvation

Under starvation conditions in late-stationary phase, the mechanistically controversial phenomenon known as adaptive mutagenesis is observed. An increase in −1-bp frameshift of lacZ revertants is used to measure adaptive mutagenesis. This is measured when cells are starved for lactose by using a genetic system harboring F' plasmids with an inactive lactose gene (lac) that can revert to lac⁺ by a specific mutation (116, 117, 315, 316, 318). The −1 frameshift reversion depends on DNA Pol IV encoded by the dinB gene. Several studies suggest that the SOS response is required for the increase in point mutations by DinB (54, 240). It is possible that DinB maybe induced by the production of ssDNA during F' amplification segregation (318). However, maximal DinB induction in late stationary phase requires the general stress response regulator RpoS (203). RpoS is necessary not only for adaptive point mutation but also for adaptive amplification in the Lac system, suggesting that transient genetic instability is induced in late stationary phase (226). In addition to carbon limitation, amino acid starvation also triggers the SOS response upon resumption of growth on glycerol (167).

Intracellular pH

E. coli cells regulate their intracellular pH through redox and proton pumps (276, 277). However, improper regulation can result in SOS induction (336). The mechanism for pH-induced expression of SOS-regulated genes might be explained by the result that pH alters the structure of the transcriptional repressor LexA (100, 355). It has been proposed that the structurally altered LexA aggregates, is degraded, and ultimately results in derepression of LexA-regulated genes ().

MECHANISMS GENERATING ssDNA

The major SOS-inducing signal is the accumulation of ssDNA, which is generated by a number of different mechanisms that ultimately result in SOS induction. During normal growth, the limited amount of ssDNA generated during DNA replication is tolerated in vivo. However, an increase in the amount of ssDNA provides a sensitive signal that requires a very low threshold for SOS induction. The most common situation that results in an increase in ssDNA occurs when the cell attempts to replicate damaged DNA (see below). However, generation of the SOS response by conversion of dsDNA to ssDNA can occur by a number of other mechanisms.

Replication of Damaged DNA

Replication is required to induce the SOS response following UV irradiation. Evidence that DNA lesions were not sufficient to induce the SOS response was obtained in experiments in which a dnaC28^TS derivative in a nucleotide excision repair defective genetic background was exposed to UV light (324). The dnaC28^TS strain has impaired DNA replication at 42° because of its temperature-sensitive helicase loader allele. When shifted to 42° after UV exposure, the uvrBdnaC28^TS double mutant fails to induce SOS, implying a role for DNA replication in the induction of the SOS response (324). Furthermore, following a 70-minute shift to 42°, UV-irradiated dnaC28^TS cells fail to cleave LexA protein, in comparison with 70% cleavage of LexA in a wild-type strain within 10 minutes at the permissive temperature of 30° (331). These results indicate that the presence of UV lesions is not sufficient to induce SOS in cells lacking nucleotide excision repair, and that an active replication fork must attempt to replicate over DNA lesions for SOS induction to occur. A slight SOS induction does occur in dnaC28^TS strains at high UV doses at the restrictive temperature, implying either that removal of lesions results in gaps that are sufficient for SOS induction (324) or that a low level of replication is supported by the dnaC28^TS allele at the restrictive temperature.

Double-Strand Breaks Are Processed by RecBCD

The spontaneous rate of double-strand break formation under normal growth conditions is very low with 0.01 breaks detected per genome for E. coli (285). Several stresses, however, including nalidixic acid, high pressure, and gamma irradiation, result in SOS induction as the result of a dsDNA break intermediate processed to ssDNA (101, 131, 353, 361). Experimental evidence suggests that the RecBCD helicase/exonuclease degrades and unwinds dsDNA creating a 3' ssDNA tail that induces SOS (Fig. 1) (149, 177). A crystal structure of the RecBCD enzyme suggests that, once the enzyme complex binds blunt-ended DNA, unwinding is initiated by the two helicases RecB and RecD and splits the two strands around the pin of RecC (350). RecB, a helicase and nuclease, initially degrades the 5' tail less efficiently than the 3' tail, which is channeled into the nuclease active site. As the 3' tail is moved toward the nuclease active site, RecC scans the DNA and binds when it recognizes a chi (5'-GCTGGTGG) sequence. Binding to a chi sequence prevents further degradation of the 3' tail and allows the 5' tail to be degraded, thus creating a 3' ssDNA tail for RecA binding. An in vitro reconstitution assay consisting of RecA, RecBCD, SSB, and LexA recapitulated the LexA derepression of an SOS promoter in the presence of a double-stranded break on DNA containing a chi site (10).

RecFOR-Mediated Processing of Arrested Replication Forks Generates ssDNA

Replication forks frequently stall because of physical blocks. The formation of an activated RecA/ssDNA nucleoprotein filament in response to a replication fork encountering a physical block, such as a UV photoproduct, requires processing by the RecFOR complex (Fig. 1) (described in detail below). recF, recO, and recR are sensitive to DNA-damaging agents, and exhibit delayed SOS induction (73, 305, 372). Several studies suggest that these proteins form a complex that enhances and stabilizes RecA binding to ssDNA, in part, through clearing SSB from ssDNA to nucleate RecA/ssDNA binding (43, 73, 256).

Furthermore, RecFOR function is required to prevent inappropriate RecQ- and RecJ-dependent degradation of the nascent strand at stalled replication forks. However, some RecQ- and RecJ-dependent processing of nascent DNA is required for replication restart following UV irradiation (73, 74). A current model, based on in vitro data, for nascent strand processing suggests that RecQ, a 3' to 5' helicase, unwinds template dsDNA ahead of the fork to remove impeding structures. RecQ then switches to the lagging strand and begins to unwind, creating a ssDNA substrate for RecJ. Limited RecJ degradation of nascent DNA provides an area of ssDNA for RecA filament formation (154), which in turn prevents extensive DNA degradation (73).

Foreign DNA

Indirect SOS induction occurs when UV-irradiated foreign DNA such as F or F' plasmids, P1, M13, bacteriophage λ, and Hfr DNA is introduced into cells (41, 42, 80, 89, 133, 317). The kinetics of SOS induction by plasmid P1 and λ are similar, as measured by sulA::lac fusion expression. However, induction of SOS is markedly reduced without bacteriophage λ DNA replication, suggesting that replication of damaged DNA and subsequent processing of the lesion are necessary at least for bacteriophage λ (80).

DNA Metabolism Mutants

Mutations in genes encoding proteins that participate in DNA metabolism can result in SOS induction; these include dam (223, 287), dnaQ (208, 351), polA (23), priA (271, 329), and uvrD (275). Point mutants in essential genes encoding components of the replicative polymerase DNA Pol III and those necessary for chromosome segregation can also induce the SOS response. Mutants of Pol III subunits, including dnaN159 (the β processivity clamp), display a partial chronic induction of SOS because of an impaired ability to interact with the catalytic subunit (363). xerCD, div, and ftsK mutants suffer from a more acute induction after the dividing septum shears chromosomes that fail to properly segregate (152, 219). Single-cell studies of mutants expressing SulA::GFP suggest that, in the case of DNA metabolism mutants, SOS induction only occurs in a subpopulation. In contrast, SOS induction in lexA(Def) mutants occurs uniformly in all cells within the culture (238), an issue that is discussed below in more detail (see "Single-cell analysis of the SOS response," below). It was suggested that SOS induction occurs in a subpopulation of the DNA metabolism mutants because the cell has several pathways to process DNA intermediates. The noninduced cells may not have experienced enough DNA damage or the cell utilized a pathway that does not require the mutated gene product for repair (238).

Decreased Nucleotide Pools Result in SOS Induction

Exposing E. coli cells to hydroxyurea, a specific inhibitor of ribonucleotide reductase, decreases the intracellular concentration of dNTPs resulting in replication fork pausing and SOS induction (20). RecA, SulA, and λ prophage induction as a result of hydroxyurea exposure is RecBC independent. Although RecA requires ATP for LexA cleavage, intracellular ATP pools are not a limiting factor for SOS induction (20, 213, 383). Survival during nucleotide starvation is enhanced by the SOS-regulated Y-family polymerases UmuC and DinB (138), possibly due to their higher affinity for dNTPs as compared with Pol III. Interestingly, in the opportunistic pathogen Serratia marcescens, hydroxyurea treatment results in the LexA-dependent induction of an exocellular nuclease-scavenging pathway (166).

STRUCTURAL INSIGHTS INTO RecA/DNA NUCLEOPROTEIN FILAMENT

Structural data are available for both the E. coli (Fig. 2) and an inactive compact Mycobacterium smegmatis complex with a bound nucleotide between RecA monomers (84, 85, 86, 358, 359, 360) showing 6 RecA monomers per turn (Fig. 2). Furthermore, conserved residues in all bacterial RecA proteins lie along the RecA monomer interface, highlighting their importance for filament formation. The recent advances in optical techniques have allowed for the real-time visualization of RecA or Rad51 polymerization on ssDNA and suggest that nucleation is the rate-limiting step (127, 170, 292). A reconstruction of electron micrographs with RecA bound to dsDNA in the presence of LexA has also been generated (418). These results show that LexA is bound to a deep groove of the RecA/dsDNA nucleoprotein filament (418). LexA contacts two adjacent RecA monomers within the 6₁ helical structure composed of 6 RecA monomers. These studies have collectively provided a picture of how RecA and RecA-like proteins form filaments on DNA in vivo.

Fig. 2Model of the RecA filament. By using electron microscopy, a model of the RecA filament was generated that positions ATP between RecA subunits. (A) The RecA filament is shown to display the DNA binding channel (Left) and then subsequently turned 90° (Right). (B) An ATP molecule (shown) binds at the interface of two RecA subunits, positioning it to explain the cooperative nature of ATP hydrolysis observed for RecA-DNA filaments. Conserved residues in bacterial RecA proteins (green) are positioned along the subunit interface near the ATP binding pocket. The figure was generated using PyMOL and PDB file 1N03.

Source: Adapted from Structure (380) with permission (http://www.sciencedirect.com).

RecA-Modulating Proteins

Proteins RecX, DinI, PsiB, RdgC, RecFOR, SSB, RecBCD, HU, and UvrD affect the formation or disassembly of RecA/ssDNA nucleoprotein filaments, thereby modulating the magnitude of the SOS response (Fig. 1). In this section, we discuss the current view of how these proteins affect SOS and direct readers to reviews that provide an in-depth view of how these proteins regulate RecA-mediated repair.

Antagonistic Functions of RecX and DinI Modulate the Stability of RecA Filaments

RecX prevents RecA/ssDNA nucleoprotein filament extension, thereby decreasing SOS induction (357). In contrast, DinI stabilizes the filament, increasing SOS induction (413, 414, 415). RecX is an SOS-induced gene product that caps the RecA filament, preventing polymerization (98, 99, 379). In vivo, RecX overexpression decreases SOS induction in some bacteria (362, 381) and, in M.smegmatis, overexpression of MsRecA is toxic in the absence of MsRecX (279, 280). However, recXE. coli strains fail to show an observable phenotype, suggesting that any RecX affect in E. coli is subtle (278, 357). It should be noted here that RecF has an inhibitory effect on RecX (228). RecF interacts with RecX and prevents RecX from exerting a negative effect on RecA (228).

The SOS-regulated DinI protein binds to and stabilizes RecA/ssDNA nucleoprotein filaments (206, 413, 414). In addition to this function, DinI interferes with UmuD cleavage to UmuD' (269, 366, 367, 386). As discussed previously, the differential affinity of LexA for SOS boxes allows for genes to be turned on early or late in the SOS response. DinI is expressed early in SOS to stabilize RecA/ssDNA nucleoprotein filaments and may thus inhibit UmuD cleavage, thereby delaying mutagenic TLS and allowing for higher-fidelity repair to take place prior to lower-fidelity TLS (182, 413, 415). The affect of DinI on RecA and UmuD is an excellent example of how many different layers of regulation help make the E. coli SOS response a sophisticated physiological response to genotoxic stress.

Recently, RecA has been fused to green fluorescent protein (GFP) to visualize localization during normal growth and following challenge with DNA-damaging agents. These experiments have revealed that the appearance and longevity of RecA-GFP foci (185, 307, 348) are altered by the absence of both dinI and recX (308). These experiments show that, although the phenotype of dinI and recX strains is subtle, the absence of these proteins affects RecA-GFP focus formation in vivo.

PsiB Limits SOS Induction during Plasmid Conjugation

PsiB protein, expressed from conjugative plasmids including F and IncN, is a potent inhibitor of the SOS response (15, 16, 18, 103, 142). During conjugation the psiB gene is located in the leading region of DNA that is transferred allowing for early expression in the recipient cell (15). The transferred ssDNA, in principle, could be considered "excess" and results in RecA binding and SOS induction. The early expression of PsiB protein prevents induction of the SOS response. Although the mechanistic details of this inhibition remain to be elucidated, the current model postulates that PsiB interferes with RecA function (for a review, see reference 76).

RdgC Competes with RecA for Binding and Inhibits LexA Cleavage in Vitro

Recombination-dependent growth (RdgC) is a DNA binding protein that binds both single- and double-stranded DNA and prevents RecA function by competing for binding sites on DNA (97, 323). The crystal structure of the RdgC dimer suggests dsDNA binding takes place in the central hole of the ring-shaped dimer (50). Binding of RdgC has been shown in vitro to inhibit RecA-dependent cleavage of LexA (97). Genetic experiments have demonstrated that the rdgC⁺ gene product is required for viability in priA mutant strains, which are deficient for replication fork restart (255). recF, recO, or recR mutants alleviate the growth phenotype of a rdgC strain, suggesting that RdgC might function in blocking aberrant RecA loading in certain genetic backgrounds (255).

RecFOR, SSB, RecBCD, and HU Influence RecA’s Access to ssDNA

An underlying theme in this section is that SOS induction is mediated by RecA filament formation. The RecFOR, SSB, and RecBCD proteins all influence SOS by affecting the accumulation of ssDNA in vivo. As mentioned above, the RecFOR proteins stimulate the loading of RecA onto ssDNA generated during replication of damaged templates (150, 151, 158, 320, 321, 328). E. coli strains that lack RecFOR function are delayed for SOS induction (231, 404). Genetic experiments have demonstrated that these proteins are in the same epistasis group, (328) and biochemical studies have shown that RecO and RecR, or RecFOR, load RecA onto SSB-covered ssDNA in purified enzyme assays (43, 338, 376, 377).

In undamaged cells, SSB affects SOS induction by outcompeting RecA for ssDNA at the replication fork, thereby preventing SOS induction (43, 197, 202). There are approximately 7,500 to 15,000 RecA monomers in E. coli when the SOS response is repressed (331, 357). In log phase cultures there are approximately 7,000 SSB monomers (~1,750 tetramers), an in vivo observation suggesting that SSB must have a stronger affinity for ssDNA to allow for normal replication to proceed in undamaged cells (382). Indeed, SSB has a strong affinity for ssDNA and SSB prevents RecA binding to ssDNA in vitro (43, 338, 376, 377). It has also been shown in vitro that RecA will only displace prebound SSB from ssDNA if RecO and RecR are added to the reaction (43, 155, 338, 376, 377). In limited circumstances, SSB can aid in RecA filamentation by removing hairpins (or other secondary structures) from ssDNA (197).

As discussed previously, the RecBCD helicase/nuclease enzyme can have a positive affect on SOS induction. E. coli RecBCD and B. subtilis AddAB are enzymes that process double-strand breaks to yield a 3' ssDNA segment that is required for RecA filament formation (9, 11, 64, 65, 92, 350).

Many bacteria, including E. coli, contain the histone-like protein HU. HU is a heterodimer composed of Hupα and Hupβ (172, 173, 174, 175). HU is important for maintenance of DNA topology involved in several aspects of DNA metabolism, including replication initiation (38, 39). Although HU binds DNA nonspecifically, HU binds to both recombination and replication intermediates with a higher affinity than it has for B-form DNA. Strains deficient for both the hupA and hupB genes show sensitivity to both UV and ionizing radiation. There are two possible reasons for this. One report shows that HU is important for SOS induction (252). A second report has shown the possibility of a direct role for HU in DNA repair. This report describes that HU binds preferentially to AP sites and contains AP lyase activity (196). However, more experiments are required to understand mechanistically how HU contributes to SOS.

POSTTRANSLATIONAL REGULATION OF SOS-INDUCED PROTEINS

The SOS response is also regulated by posttranslational protein modification. Interestingly, some of the first insights into regulation of the SOS response by posttranslational modifications came from studies on λ prophage, which can induce its lytic cycle upon sensing ssDNA. Early work by Roberts and colleagues demonstrated that exposure of λ lysogens to UV-irradiation or mitomycin C results in a RecA-dependent cleavage of λcI, a repressor of phage lytic genes, resulting in induction of the lytic cycle. Experiments using recA(Def) and λcI(Ind^-) strains suggested that λcI cleavage activates expression of phage genes and that RecA acts as a regulator of the protease or was the protease itself (309). Subsequent studies established that λcI is cleaved between the Ala¹¹¹–Gly¹¹² bond, generating two nearly equal proteolytic fragments in an ATP/ssDNA-dependent reaction (78, 79, 157, 332). This cleavage prevents the formation of a λcI homodimers that bind to λ operator sequences because the cleavage separates the operator binding domain and the dimer interface domain (217). These results led to the conclusion that RecA is activated for an ATP-dependent role in λ repressor cleavage when bound to ssDNA in a ternary complex. The ternary complex, the RecA/ssDNA nucleoprotein filament, is now understood to be a coprotease required to induce and stabilize a conformational change in λcI that brings the self-cleavage site in close proximity to the serine protease active site (187, 267).

As described earlier, SOS-controlled genes are induced when the LexA repressor undergoes an autoproteolytic cleavage event similar to that of λ repressor. Like λ repressor, the cleavage of LexA is facilitated by the RecA nucleoprotein filament on ssDNA (46, 157, 213, 214, 217, 218). Experiments using extracts from cells containing radiolabeled LexA demonstrated that the protein is cleaved nearly in half. The cleavage of the 22.7-kDa protein occurs between the Ala⁸⁴–Gly⁸⁵ bond, and the kinetics suggest a more rapid cleavage event than λ phage (157, 218). In vivo, the half-life of LexA is approximately 1 hour in uninduced cells, but cleavage begins one minute after UV exposure and is complete within 5 minutes. The in vitro kinetics of LexA cleavage is first order and is independent of protein concentration, suggesting an intramolecular reaction with respect to the homodimer (331).

The domains necessary for RecA-mediated cleavage and autodigestion are located in the C-terminal domain of LexA (Fig. 3). Indeed, crystal structure analysis of the LexA C terminus suggests that the protein exists in two states, noncleavable and cleavable (227, 393). In the noncleavable form, the cleavage site is positioned 20 Å away from the Ser–Lys dyad cleavage active site. In the cleavable conformation, the Ala⁸⁴–Gly⁸⁵ bond is positioned to participate in the autoproteolytic cleavage reaction catalyzed by the Ser–Lys dyad. In the Ser–Lys dyad model of LexA cleavage, the uncharged Lys¹⁵⁶ removes a proton from Ser¹¹⁹ creating a nucleophile to attack the Ala⁸⁴–Gly⁸⁵ bond (209, 210, 306, 311). Isolation of lexA(Ind^S) mutants that increase the rate of LexA cleavage support the existence of two LexA structural conformations in vivo (312, 352). These results suggest that the RecA nucleoprotein filament does not participate directly in the proteolysis reaction, but instead induces a conformational change favoring LexA cleavage. For this reason RecA is termed a coprotease. In addition to the coprotease activity of RecA, full induction of the SOS response is ensured by ClpXP-mediated degradation of LexA fragments, preventing repressor activity mediated by the LexA N-terminal fragment (268).

Fig. 3Structural analysis of posttranslationally modified SOS proteins reveals catalytically competent and noncompetent protein conformations. LexA (A) and UmuD (B) proteins undergo a large rearrangement from a noncleavable conformation (NC) to a cleavable conformation (C). (A) LexA crystal structures indicate that the Ala⁸⁴-Gly⁸⁵ residues (purple) can be positioned 20 Ã away from Lys¹⁵⁶ (green) and Ser¹¹⁹ (orange) in the NC form (Left) to a position allowing for an autoproteolytic cleavage event in the cleavable form (Right) (227). (B) Full-length models of the noncleavable (Left) and cleavable (Center) UmuD₂ dimer. The N-terminal arms of UmuD₂ (purple) fold to present the cleavage site (C24 purple spheres) to Ser⁶⁰ (orange) and Lys⁹⁷ (green) (compare Left and Center). NMR data suggest that after the cleavage event forming UmuD'₂ (Right), the dimer undergoes a significant conformational change that consequently alters cellular activity.

Source: Adapted from Trends in Microbiology (168), Molecular Cell (227), Nature (284), and DNA Repair (365) with permission (http://www.sciencedirect.com).

UmuD also undergoes a similar Ser–Lys dyad-catalyzed proteolysis event (Fig. 3) that regulates TLS and a DNA damage prokaryotic checkpoint (see "Bacterial cell cycle checkpoints," below). The catalytic core of UmuD shares structural homology to LexA and forms homodimers in solution (112, 284, 365). Like LexA, the proteolysis event is catalyzed by a Ser⁶⁰–Lys⁹⁷ dyad that is within hydrogen bonding distance with the cleavage site, Cys²⁴–Gly²⁵, in the presence of the RecA coprotease (53, 284, 341). Unlike LexA, UmuD structural studies support an intermolecular reaction due to the N-terminal arms folding in such a way as to then cleave sites in close proximity to the Ser–Lys dyad of the partner in the homodimer (365). The UmuD₂ proteolysis event removes the unstructured N-terminal 24 amino acids generating UmuD'₂. After cleavage, the new N terminus is able to move more freely and a large conformational change occurs, presumably activating the protein for TLS (168, 284).

IDENTIFICATION OF GENES IN SOS NETWORK

To understand the breadth of E. coli responses to DNA damage, a genetic approach was used in a systematic search for genes induced as part of the SOS network. The Mu d1 bacteriophage (59), which generates chromosomal operon fusions to lacZ, was used to create a set of random transcriptional fusions. These fusion strains were screened for genes that expressed a higher level of β-galactosidase when treated with UV or mitomycin C (MMC). From this experiment a set of din (damage-inducible) genes were isolated (182), whose expression was not detected in genetic backgrounds containing recA (Def) and lexA (Ind⁻) alleles. Later genetic and biochemical studies showed that LexA was the direct repressor of the din genes (181). This technique was also used in a more directed experiment to generate fusions to genes suspected to be controlled by the SOS regulon. Such genes include uvrA⁺ (183), uvrB⁺ (115, 183), sulA⁺ (160), umuDC⁺ (17), uvrD⁺ (12, 345), himA⁺ (250), ruvA⁺ and ruvB⁺ (344), recA⁺ (60), and recN⁺ (222). At the time this chapter was written, 57 genes have been shown to be repressed by LexA (Table 1).

A computational search for LexA-regulated genes was enabled by identifying a consensus sequence for the LexA box and the complete genome sequence of E. coli (113). In this study, LexA-regulated genes were identified by searching the E. coli genome for potential LexA binding sites. These LexA-regulated genes were then verified to be damage inducible, and LexA regulated in vivo. This work also showed that LexA bound several of these promoter regions in vitro (113).

While lacZ transcriptional fusions and computational analysis were important breakthroughs in understanding the genes that comprise the SOS response, microarrays and chromatin immunoprecipitation followed by microarray analysis (ChIP-on-chip) now serve as a high-throughput method for monitoring changes in gene expression, and promoter occupation by LexA (75, 388). One microarray analysis (75) examined changes in gene expression following UV irradiation in wild-type and lexA(Ind⁻) genetic backgrounds. These results confirmed the induction of known lexA⁺-regulated genes, and also identified 17 previously unidentified lexA⁺-regulated genes. In addition, genes up-regulated by a lexA⁺-independent mechanism and genes down-regulated in response to SOS induction were also identified. Transcripts expressed independently of LexA can be explained by downstream or secondary affects of genes regulated directly by LexA. For example, LexA may repress a gene that is required to regulate expression of a second gene. It is still unknown if transcripts down-regulated by UV irradiation occur through a lexA⁺-dependent or independent mechanism. Other microarray studies have examined the transcriptional response to UV and mitomycin C (184, 296).

While it has been known for many years that LexA acts as a transcriptional repressor of the SOS response, recent studies suggest that sole repression of the SOS response by LexA may be an oversimplification. The SOS regulatory system has been used to construct synthetic gene networks, and in E. coli some lexA⁺-regulated genes have been shown to have another regulatory component (130, 193). For example, the dinB⁺ gene is a member of the SOS regulon, which is repressed by lexA⁺, but its expression is also regulated by the stress response sigma factor RpoS, thereby inducing dinB⁺ transcript levels in stationary phase independently of LexA (203).

Similar efforts have been made to characterize the SOS response in a variety of other bacteria (for a review, see reference 110). Microarray data show that B.subtilis contains a recA⁺/lexA⁺-dependent SOS system, although only 8 genes of 62 induced by the SOS have analogous counterparts in E. coli (13). Interestingly, studies in Mycobacterium tuberculosis and Myxococcus xanthus imply both a lexA⁺-dependent and an uncharacterized lexA⁺-independent mechanism for induction of the DNA damage response (57, 302).

SINGLE-CELL ANALYSIS OF THE SOS RESPONSE

The application of fluorescent microscopy to SOS studies has demonstrated the limitations of measuring SOS induction at the population level in cultures (51, 238). For example, when β-galactosidase activity is measured in cell culture by using a lacZ transcriptional fusion to an SOS-regulated promoter, the results represent a population average. In such experiments, it had not been clear whether a given promoter’s activity is similar in every cell or differentially expressed in subpopulations of cells (182, 324, 331). These models have been described as the "uniform expression model" or the "two-population model," respectively (238). To determine SOS induction at the single -cell level, gfp⁺ was fused to the SOS-regulated sulA⁺ promoter. GFP fluorescence was measured in a comprehensive set of genetic backgrounds that have previously been shown to result in chronic SOS induction. Analysis of these results led to the conclusion that the "two-population model" can explain most strains deficient or conditional for genes involved in DNA metabolism. The exceptions to this conclusion are strains deficient for lexA⁺ or recA⁺ because these cells are either never induced or induced constitutively giving a uniform gene expression pattern (238).

SOS MUTAGENESIS

Mutagenesis, induced by UV as well as a variety of chemical agents, is an active process (105, 120, 221, 262, 390, 391, 392, 408). This active cellular process involves specialized DNA polymerases that are capable of inserting nucleotides opposite a misinstructional or noninstructional lesion, allowing continuation of replicative DNA synthesis. These polymerases, termed translesion DNA polymerases, are the main contributors to the process referred to as SOS mutagenesis, error-prone repair, SOS repair, misrepair, and SOS processing. UV-induced mutagenesis can be blocked by certain lexA and recA alleles, implying a role for SOS-induced gene products in SOS mutagenesis (49, 258, 395, 405, 406).

UmuD'₂C (Pol V)-Dependent Mutagenesis

A screen for nonmutable E. coli strains led to the discovery of the umuD⁺ and umuC⁺ genes. umuD⁺ and umuC⁺ are located in an operon, within the SOS regulon, and encode proteins with molecular weights of 15,000 and 45,000, respectively (107, 342). UmuD protein is present at ~180 copies per uninduced lexA⁺ cell and ~2,400 copies per lexA(Def) cell (411). The levels of UmuC protein in a lexA(Def) background is ~200 molecules per cell and was too low to be measured under non-SOS-induced conditions (411). UmuD forms dimers, which undergo RecA-mediated autocleavage, to form UmuD'₂ homodimers. It is these UmuD'₂ homodimers that function together with UmuC to form the active version of E. coli TLS polymerase Pol V (UmuD'₂C). Deletion of either the umuD⁺ or umuC⁺ genes abolishes the mutagenic affect of a wide variety of agents, including UV, 4-nitroquinoline-1-oxide and methyl methanesulfonate (88, 107, 120, 178, 342, 356, 391, 400, 407, 408). Strains defective in umuC or umuD, however, retain the ability to be mutated by certain agents, including the methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). MNNG generates O⁶-methylguanine, which has the potential to result in direct mispairing during replication because O⁶-methylguanine can pair with either C or T. Although umuD or umuC strains are UV sensitive, it is a modest phenotype, and not nearly as sensitive as uvr mutants. In addition, Pol V-dependent mutagenesis requires RecA to regulate the cleavage of UmuD to UmuD' (24, 53, 269, 341, 368). Recent results have shown that two RecA molecules are important for mediating Pol V lesion bypass (289, 333). Taken together, RecA and Pol V collaborate to form a complex capable of lesion bypass. Finally, the molecular chaperones GroES and GroEL are required for Pol V-dependent UV-induced mutagenesis, possibly functioning to help stabilize UmuC by facilitating proper folding (94, 95, 220). Consistent with this conclusion, the half-life of UmuC decreases in groE strains (95).

DinB (Pol IV)-Dependent Mutagenesis

Another E. coli TLS polymerase, Pol IV, encoded by dinB⁺, was identified among a series of damage-inducible (din) genes and plays a role in SOS mutagenesis (182). DinB has a molecular weight of 40,000, and is present at ~250 molecules per lexA⁺ cell and ~2,500 molecules per lexA(Def) cell (189). While dinB phenotypes have been more elusive than those of umuDC, dinB⁺ is required for λ-untargeted mutagenesis. Untargeted mutagenesis of bacteriophage λ DNA is observed when UV-irradiated E. coli are transfected with unirradiated λ phage (52). DinB is also important for adaptive mutagenesis. Adaptive mutagenesis has been measured by using reversion of a −1 frameshift in a lacIlacZ fusion. In this assay developed by Cairns and Foster (54), cells are plated on minimal lactose medium, under nonlethal selection, resulting in the appearance of lac⁺ revertants over several days (for a review on adaptive mutagenesis, see reference 153). Although the mechanism by which adaptive mutations occur is controversial, it is clearly DinB dependent, because dinB strains result in a 5- to 10-fold reduction in adaptive mutants (153). DinB activity is modulated by a host of other proteins in vivo, including RpoS, GroE, and Ppk (for a review, see reference 117a). In addition, RecA, UmuD, and UmuD' regulate DinB −1 frameshift activity based on the structure of the DNA primer terminus demonstrating a nuanced regulation of −1 frameshift activity (137). These results demonstrate that RecA, UmuD, and UmuD' act as accessory factors for Pol IV, modulating the mutagenic capability of this polymerase. Furthermore, DinB allows for resistance to N²-dG adducts including N²-furfuryl-dG (169). It was shown that DinB preferentially bypassed N²-furfuryl-dG with higher proficiency than an undamaged dG, suggesting that DinB homologs are specialized for bypass of bulky N²-dG adducts in vivo (169).

Pol II-Dependent Mutagenesis

DNA Pol II is encoded by the polB⁺ (or dinA) gene, which is damage inducible (40, 294). Pol II translesion synthesis is often accurate across from 3, N⁴-ethenocytosine adducts (5) and Pol II efficiently bypasses abasic as well as interstrand cross links (32, 176). Pol II contains the 3'-5' proofreading exonuclease activity present in high-fidelity polymerases, yet Pol II can be mutagenic. A rather striking observation is that Pol II is more mutagenic at AT-rich sites than in GC-rich sites, which is unexpected for a proofreading polymerase (398). It was reasoned that Pol II has a preference for extension in AT-rich sequences owing to the higher mutation frequency (398).

Also, challenge of E. coli with N²-acetylaminofluorene (AAF) results in −1 and −2 frameshift mutagenesis by both Pol II and Pol V (265). Although this review does not cover the topic of replication fork restart, it should be noted that Pol II has an established role in this process. The action of Pol II is coordinated with primosomal protein PriA and the RecFOR proteins (303, 304, 305).

BACTERIAL CELL CYCLE CHECKPOINTS

Cell cycle checkpoints have been well studied in eukaryotic organisms because of their importance in understanding cell cycle regulation and the clear links between the bypass of checkpoints and the development of cancer (14, 224, 301, 397). E. coli spatially regulates the cell cycle, i.e., DNA replication can occur at the one-quarter and three-quarter positions in the cell while cell division mechanisms occur at midcell (136, 200, 235, 319, 322, 340). This spatial separation of cell cycle events allows for initiation of a new round of replication before the previous round has completed (71, 93). The spatial regulation also allows arrest of certain cell cycle processes, but not necessarily arrest of all cell cycle processes (118). The lack of temporal cell cycle stringency has resulted in qualifying prokaryotic checkpoints as "primitive checkpoints" and "checkpoint-like" (48, 119, 273, 367).

The purpose of checkpoints, in both eukaryotes and prokaryotes, is to maintain genomic integrity and avoid cell death by preventing the overlap of cell cycle events. The cell is particularly vulnerable to loss of genomic integrity at ssDNA regions near stalled replication forks. Furthermore, formation of the RecA/ssDNA nucleoprotein filament results in the induction of prokaryotic checkpoints that prevent overlap of cell cycle events. The DNA damage and cell division checkpoints are regulated by the SOS response specifically by inducing the umuDC⁺ and sulA⁺ (273, 369) gene products. Like their eukaryotic counterparts, these gene products are not necessary for the cell cycle events themselves but enforce proper execution, which is especially important following DNA damage.

The SulA-Dependent DNA Damage Prokaryotic Checkpoint

Expression of the cell division inhibitor SulA (also sfiA⁺) is controlled by LexA and is up-regulated following DNA damage. SulA directly prevents cell division by binding to FtsZ (35, 72, 369). FtsZ, a tubulin homolog, forms a ring at midcell (Z-ring) providing a scaffold for other cell division proteins to bind to and promote cytokinesis (401). X-ray crystallography data show that SulA binds to FtsZ as a dimer (72). This direct interaction presumably prevents FtsZ polymerization into a Z-ring, thereby acting as a prokaryotic cell division checkpoint. The block to septation results in the formation of cellular filaments, cells that continue to grow but fail to divide, and was one of the first phenotypes observed in SOS-induced cells.

The presumed purpose of the SulA-dependent checkpoint is to prevent distribution of damaged chromosomes to daughter cells. This allows sister chromosomes to be used for homologous recombination to repair double-strand breaks and to tolerate DNA lesions. In addition, SulA helps temporally to coordinate repair functions and cell division. Without proper coordination, nucleoids can be guillotined, meaning that the cell division plane closes on unsegregated chromosomes resulting in a double-strand break. This phenotype is observed in xerCD, div, ftsK, and sulA mutants (30, 219, 394, 401). As mentioned above, FtsK is an SOS-inducible, ATP-dependent DNA pump that is required for cell division and chromosome localization under normal growth conditions. However, increased resistance to UV radiation and mitomycin C exposure have been observed after overexpression of FtsK (394). The mechanism for FtsK-mediated increase in survival is not known.

The UmuDC-Dependent DNA Damage Prokaryotic Checkpoint

A model for a umuDC⁺-dependent prokaryotic checkpoint was proposed on the basis of studies demonstrating cold sensitivity caused by UmuDC⁺ overexpression (236, 237). UmuDC’s role in this cold-sensitive growth phenotype is distinct from UmuDC’s role in SOS mutagenesis (237, 274). A umuD missense mutation (S60A) results in a noncleavable UmuD that prevents SOS mutagenesis, but has no adverse effect on UmuDC⁺-mediated cold sensitivity (274). Subsequent experiments with umuD (S60A) revealed that expression of the noncleavable UmuD protein resulted in increased survival following UV irradiation and a modest decrease in DNA replication in a uvr⁺-dependent manner (273). The increase in UV resistance and a decrease in DNA replication occurred despite the inability of a noncleavable UmuD to participate in translesion synthesis. In addition, kinetics of UmuD cleavage to UmuD' was comparable to the kinetics of UV-induced lesion removal by UvrA, and the kinetics of cleavage was UV dose dependent.

These observations led to the umuDC⁺-dependent, DNA damage prokaryotic checkpoint model in which UmuD has two distinct roles. First, the UmuD₂ dimer in complex with UmuC delays the recovery of DNA replication and cell growth after DNA damage possibly by inhibiting Pol III at replication forks. This DNA damage checkpoint allows accurate repair of DNA damage before replication is attempted. If accurate repair mechanisms are insufficient, the eventual RecA-mediated cleavage of UmuD₂ to UmuD'₂ then permits UmuD'₂C (DNA Pol V) to carry out TLS over any remaining damage (273).

The umuDC⁺ DNA damage checkpoint model suggests that both UmuD₂C and UmuD₂'C have access to the replication fork and slow or arrest Pol III. Indeed, UmuD and UmuD' have been shown to interact with various subunits of the Pol III holoenzyme (364). Affinity chromatography has shown that UmuD₂ has a greater affinity for the βprocessivity clamp than does UmuD'₂. In contrast, UmuD'₂ interacts more strongly than UmuD₂ with the catalytic subunit, while both proteins interact equally with the epsilon proofreading subunit. Subsequent genetic analysis demonstrated that co-overexpression of β or epsilon with UmuDC abrogated the cold-sensitive phenotype (366).

INDUCIBLE GENE EXPRESSION INDEPENDENT OF THE CLASSICAL SOS REGULON

It has become increasingly clear that many bacteria mount a robust transcriptional response to DNA damage independently of recA⁺ and lexA⁺. Although a large proportion of the DNA damage-inducible genes in E. coli and B. subtilis are regulated by recA⁺ and lexA⁺, others are not (Table 1) (75, 144, 184). In both of these organisms, many genes that lack an identifiable SOS box are expressed following challenge with DNA-damaging agents in lexA (Ind⁻) or recA strains. In E. coli, transcription of approximately one third of the open reading frames in the genome is altered following mitomycin C challenge (184). This could be explained by the fact that mitomycin C is not specific for DNA and it reacts with other cellular components including proteins contributing to alterations in gene expression. Other DNA-damaging agents such as UV irradiation are much more specific for DNA (102) and it is this difference that likely accounts for the gene expression data that were observed following challenge with MMC. In B. subtilis, the expression of 668 genes is altered following replication fork arrest with HPUra, 500 of which are regulated by recA⁺ and/or lexA⁺ (144). Most of these 500 genes are thought to be regulated indirectly since SOS boxes are located upstream of only a subset of these genes.

DnaA protein is required for the initiation of DNA replication and it acts as a transcription factor. DnaA is an example of a transcription factor that affects gene expression in response to DNA damage and replication fork arrest independent of the lexA and recA genes. In B. subtilis, DnaA regulates 12 genes following treatment with mitomycin C and 57 genes following replication fork arrest with the selective replicative polymerase inhibitor HPUra (13, 143, 144).

Microarrays have been used to characterize the DNA damage response in several bacteria, including Mycobacterium tuberculosis, Myxococcus xanthus, and Bdellovibrio bacteriovorus. These studies have shown that damage-inducible gene expression, in these species, can also occur independently of the recA⁺ or lexA⁺ genes (57, 58, 87, 302). Taken together, the transcriptional response to DNA damage encompasses more than just lexA⁺recA⁺-regulated genes.

THE DNA DAMAGE RESPONSE REGULATES VIRULENCE FACTORS

In several pathogenic bacteria, mobile genetic elements encode virulence factors. In addition, many of these elements are regulated by the DNA damage response (for a review, see reference 180). In S.aureus, bacteriophage φ11 and 80α are under control of SOS (139, 232, 233, 373, 374, 375). Replication and transfer of these phages results in horizontal gene transfer of virulence factors (373). Vibrio cholerae contains SXT, an integrative conjugative element (ICE) that contains several genes encoding antibiotic resistance to chloramphenicol, trimethoprim, streptomycin, and sulfamethoxazole. Transfer of SXT is regulated by the DNA damage response (25, 26, 27, 28, 156). SXT encodes SetR, which interacts with the RecA/ssDNA nucleoprotein filament, resulting in cleavage of SetR. SetR normally represses the expression of several activators that are required for SXT transfer. RecA/ssDNA cleavage of SetR thereby alleviates repression of the activators necessary for transfer of the element (27, 28). V. cholerae also encodes CTXφ , a temperate filamentous phage that encodes cholera toxin (298, 299). LexA cleavage through interaction with RecA/ssDNA nucleoprotein filament is required for CTXφ induction. The LexA binding site overlaps with the promoter region recognized by the alpha C-terminal domain of RNA polymerase preventing gene activation (298).

In enteropathogenic E. coli, the locus of enterocyte effacement (LEE) is SOS regulated and responds to positive regulation by Ler and negative regulation by LexA (243). The LEE locus also encodes the type III secretion system responsible for secretion of virulence-associated factors into host cells. The components of the type III secretion are encoded by the divergently transcribed LEE2 and LEE3 operons contained within LEE (108). LexA occupies the divergent promoter region repressing transcription of LEE2/3 (243). Furthermore, the expression of LEE2/3 requires a cleavable LexA. These examples demonstrate that the DNA damage response regulates the dissemination of antibiotic resistance genes, genes encoding the cholera toxin, and the type III secretion system in some bacteria.

CONCLUSIONS

The SOS response in E. coli is a complex genetic circuit that allows cells to sense damage to their genetic material and respond with both high- and low-fidelity repair. This chapter highlights many experiments that have shaped our understanding of the SOS response in E. coli and other organisms. We hope that readers have gained not only an appreciation for what is known about the response, but also an appreciation for the complexity of this response and the work that has yet to be done. Two of the major challenges will be to understand how cells coordinate DNA damage recognition with DNA replication and to provide a structural basis for how protein-protein interactions contribute to regulation of the pathway. Other challenges in understanding the SOS response in E. coli will be to determine how the SOS response is coordinated with other physiological responses.

The analysis of SOS in other bacteria has opened an entirely new area of investigation. We think it is clear that many gram-positive and gram-negative bacteria respond to DNA damage by affecting gene expression, but the specific genes affected vary considerably from organism to organism. Detailed examination of SOS in a variety of bacterial species will add considerably to our knowledge of the mechanisms regulating SOS and the genes under SOS control. These studies will help determine how the SOS circuitry is plugged into other gene networks that allow for a given bacterium to thrive within its niche.

ACKNOWLEDGMENTS

We acknowledge the tireless efforts of all the laboratories around the world that have studied the SOS response over the past 50 years. We thank John W. Foster and two anonymous reviewers for their comments that have strengthened this chapter. We also apologize to our colleagues for not being able to cite all of the papers that have contributed to our understanding of the SOS response.

This work was supported by National Cancer Institute Grant CA21615 (to G.C.W.), National Institute of Environmental Health Sciences Grant P30 ES002109 (to G.C.W.), and an American Cancer Society Research Professorship (to G.C.W.). A postdoctoral fellowship from the National Cancer Institute supported L.A.S.

References

1. Adams, R. L., R. H. Burdon, K. MacKinnon, and A. Rinaldi. 1983. Stimulation of de novo methylation following limited proteolysis of mouse ascites DNA methylase. FEBS Lett. 163:194–198.[PubMed] [CrossRef]

2. Aertsen, A., and C. W. Michiels. 2005. Mrr instigates the SOS response after high pressure stress in Escherichia coli. Mol. Microbiol. 58:1381–1391.[PubMed]

3. Aertsen, A., R. Van Houdt, K. Vanoirbeek, and C. W. Michiels. 2004. An SOS response induced by high pressure in Escherichia coli. J. Bacteriol. 186:6133–6141.[PubMed] [CrossRef]

4. Aksenov, S. V. 1999. Dynamics of the inducing signal for the SOS regulatory system in Escherichia coli after ultraviolet irradiation. Math. Biosci. 157:269–286.[PubMed] [CrossRef]

5. Al Mamun, A. A., and M. Z. Humayun. 2006. Escherichia coli DNA polymerase II can efficiently bypass 3,N(4)-ethenocytosine lesions in vitro and in vivo. Mutat. Res. 593:164–176.[PubMed]

6. Alberts, B. M., F. J. Amodio, M. Jenkins, E. D. Gutmann, and F. L. Ferris. 1968. Studies with DNA-cellulose chromatography. I. DNA-binding proteins from Escherichia coli. Cold Spring Harbor Symp. Quant. Biol. 33:289–305.[PubMed]

7. Alpa, H., N. Kalchayanand, F. Bozoglu, and B. Ray. 2000. Interactions of high hydrostatic pressure, pressurization temperature and pH on death and injury of pressure-resistant and pressure-sensitive strains of foodborne pathogens. Int. J. Food Microbiol. 60:33–42.[PubMed] [CrossRef]

8. Andersen, P. S., J. M. Smith, and B. Mygind. 1992. Characterization of the upp gene encoding uracil phosphoribosyltransferase of Escherichia coli K12. Eur. J. Biochem. 204:51–56.[PubMed] [CrossRef]

9. Anderson, D. G., and S. C. Kowalczykowski. 1997. The recombination hot spot chi is a regulatory element that switches the polarity of DNA degradation by the RecBCD enzyme. Genes Dev. 11:571–581.[PubMed] [CrossRef]

10. Anderson, D. G., and S. C. Kowalczykowski. 1998. Reconstitution of an SOS response pathway derepression of transcription in response to DNA breaks. Cell 95:975–979.[PubMed] [CrossRef]

11. Anderson, D. G., and S. C. Kowalczykowski. 1997. The translocating RecBCD enzyme stimulates recombination by directing RecA protein onto ssDNA in a chi-regulated manner. Cell 90:77–86.[PubMed] [CrossRef]

12. Arthur, H. M., and P. B. Eastlake. 1983. Transcriptional control of the uvrD gene of Escherichia coli. Gene 25:309–316.[PubMed] [CrossRef]

13. Au, N., E. Kuester-Schoeck, V. Mandava, L. E. Bothwell, S. P. Canny, K. Chachu, S. A. Colavito, S. N. Fuller, E. S. Groban, L. A. Hensley, T. C. O'Brien, A. Shah, J. T. Tierney, L. L. Tomm, T. M. O'Gara, A. I. Goranov, A. D. Grossman, and C. M. Lovett. 2005. Genetic composition of the Bacillus subtilis SOS system. J. Bacteriol. 187:7655–7666.[PubMed] [CrossRef]

14. Aylon, Y., and M. Oren. 2007. Living with p53, dying of p53. Cell 130:597–600.[PubMed] [CrossRef]

15. Bagdasarian, M., A. Bailone, J. F. Angulo, P. Scholz, and R. Devoret. 1992. PsiB, and anti-SOS protein, is transiently expressed by the F sex factor during its transmission to an Escherichia coli K-12 recipient. Mol. Microbiol. 6:885–893. [CrossRef]

16. Bagdasarian, M., A. Bailone, M. M. Bagdasarian, P. A. Manning, R. Lurz, K. N. Timmis, and R. Devoret. 1986. An inhibitor of SOS induction, specified by a plasmid locus in Escherichia coli. Proc. Natl. Acad. Sci. USA 83:5723–5726.[PubMed] [CrossRef]

17. Bagg, A., C. J. Kenyon, and G. C. Walker. 1981. Inducibility of a gene product required for UV and chemical mutagenesis in Escherichia coli. Proc. Natl. Acad. Sci. USA 78:5749–5753.[PubMed] [CrossRef]

18. Bailone, A., A. Backman, S. Sommer, J. Celerier, M. M. Bagdasarian, M. Bagdasarian, and R. Devoret. 1988. PsiB polypeptide prevents activation of RecA protein in Escherichia coli. Mol. Gen. Genet. 214:389–395.[PubMed] [CrossRef]

19. Baquero, M. R., M. Bouzon, J. Varea, and F. Moreno. 1995. sbmC, a stationary-phase induced SOS Escherichia coli gene, whose product protects cells from the DNA replication inhibitor microcin B17. Mol. Microbiol. 18:301–311.[PubMed] [CrossRef]

20. Barbe, J., A. Villaverde, and R. Guerrero. 1987. Induction of the SOS response by hydroxyurea in Escherichia coli K12. Mutat. Res. 192:105–108.[PubMed] [CrossRef]

21. Barondess, J. J., and J. Beckwith. 1990. A bacterial virulence determinant encoded by lysogenic coliphage lambda. Nature 346:871–874.[PubMed] [CrossRef]

22. Barondess, J. J., and J. Beckwith. 1995. bor gene of phage lambda, involved in serum resistance, encodes a widely conserved outer membrane lipoprotein. J. Bacteriol. 177:1247–1253.[PubMed]

23. Bates, H., S. K. Randall, C. Rayssiguier, B. A. Bridges, M. F. Goodman, and M. Radman. 1989. Spontaneous and UV-induced mutations in Escherichia coli K-12 strains with altered or absent DNA polymerase I. J. Bacteriol. 171:2480–2484.[PubMed]

24. Battista, J. R., T. Ohta, T. Nohmi, W. Sun, and G. C. Walker. 1990. Dominant negative umuD mutations decreasing RecA-mediated cleavage suggest roles for intact UmuD in modulation of SOS mutagenesis. Proc. Natl. Acad. Sci. USA 87:7190–7194.[PubMed] [CrossRef]

25. Beaber, J. W., V. Burrus, B. Hochhut, and M. K. Waldor. 2002. Comparison of SXT and R391, two conjugative integrating elements: definition of a genetic backbone for the mobilization of resistance determinants. Cell. Mol. Life Sci. 59:2065–2070.[PubMed] [CrossRef]

26. Beaber, J. W., B. Hochhut, and M. K. Waldor. 2002. Genomic and functional analyses of SXT, an integrating antibiotic resistance gene transfer element derived from Vibrio cholerae. J. Bacteriol. 184:4259–4269.[PubMed] [CrossRef]

27. Beaber, J. W., B. Hochhut, and M. K. Waldor. 2004. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature 427:72–74.[PubMed] [CrossRef]

28. Beaber, J. W., and M. K. Waldor. 2004. Identification of operators and promoters that control SXT conjugative transfer. J. Bacteriol. 186:5945–5949.[PubMed] [CrossRef]

29. Becherel, O. J., and R. P. Fuchs. 2001. Mechanism of DNA polymerase II-mediated frameshift mutagenesis. Proc. Natl. Acad. Sci. USA 98:8566–8571.[PubMed] [CrossRef]

30. Begg, K. J., S. J. Dewar, and W. D. Donachie. 1995. A new Escherichia coli cell division gene, ftsK. J. Bacteriol. 177:6211–6222.[PubMed]

31. Benz, E. W., Jr., D. Reinberg, R. Vicuna, and J. Hurwitz. 1980. Initiation of DNA replication by the dnaG protein. J. Biol. Chem. 255:1096-106.

32. Berardini, M., P. L. Foster, and E. L. Loechler. 1999. DNA polymerase II (polB) is involved in a new DNA repair pathway for DNA interstrand cross-links in Escherichia coli. J. Bacteriol. 181:2878–2882.[PubMed]

33. Berg, O. 1988. Selection of DNA binding sites by regulatory proteins: the LexA protein and the arginine repressor use different strategies for functional specificity. Nucleic Acids. Res. 16:5089–5105.[PubMed] [CrossRef]

34. Bertrand-Burggraf, E., S. Hurstel, M. Daune, and M. Schnarr. 1987. Promoter properties and negative regulation of the uvrA gene by the LexA repressor and its amino-terminal DNA binding domain. J. Mol. Biol. 193:293–302.[PubMed] [CrossRef]

35. Bi, E., and J. Lutkenhaus. 1993. Cell division inhibitors SulA and MinCD prevent formation of the FtsZ ring. J. Bacteriol. 175:1118–1125.[PubMed]

36. Blanco, M., G. Herrera, P. Collado, J. E. Rebollo, and L. M. Botella. 1982. Influence of RecA protein on induced mutagenesis. Biochimie 64:633–636.[PubMed] [CrossRef]

37. Blazquez, J., J. M. Gomez-Gomez, A. Oliver, C. Juan, V. Kapur, and S. Martin. 2006. PBP3 inhibition elicits adaptive responses in Pseudomonas aeruginosa. Mol. Microbiol. 62:84–99.[PubMed] [CrossRef]

38. Bonnefoy, E., and J. Rouviere-Yaniv. 1991. HU and IHF, two homologous histone-like proteins of Escherichia coli, form different protein-DNA complexes with short DNA fragments. EMBO J. 10:687–696.[PubMed]

39. Bonnefoy, E., and J. Rouviere-Yaniv. 1992. HU, the major histone-like protein of E. coli, modulates the binding of IHF to oriC. EMBO J. 11:4489–4496.[PubMed]

40. Bonner, C. A., S. Hays, K. McEntee, and M. F. Goodman. 1990. DNA polymerase II is encoded by the DNA damage-inducible dinA gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 87:7663–7667.[PubMed] [CrossRef]

41. Borek, E., and A. Ryan. 1973. Lysogenic induction. Prog. Nucleic Acid Res. Mol. Biol. 13:249–300.[PubMed] [CrossRef]

42. Borek, E., and A. Ryan. 1958. The transfer of irradiation-elicited induction in a lysogenic organism. Proc. Natl. Acad. Sci. USA 44:374–377.[PubMed] [CrossRef]

43. Bork, J. M., M. M. Cox, and R. B. Inman. 2001. The RecOR proteins modulate RecA protein function at 5' ends of single-stranded DNA. EMBO J. 20:7313–7322.[PubMed] [CrossRef]

44. Brandsma, J. A., D. Bosch, M. de Ruyter, and P. van de Putte. 1985. Analysis of the regulatory region of the ssb gene of Escherichia coli. Nucleic Acids Res. 13:5095–5109.[PubMed] [CrossRef]

45. Brent, R. 1982. Regulation and autoregulation by lexA protein. Biochimie 64:565–569.[PubMed] [CrossRef]

46. Brent, R., and M. Ptashne. 1980. The lexA gene product represses its own promoter. Proc. Natl. Acad. Sci. USA 77:1932–1936.[PubMed] [CrossRef]

47. Brent, R., and M. Ptashne. 1981. Mechanism of action of the lexA gene product. Proc. Natl. Acad. Sci. USA 78:4204–4208.[PubMed] [CrossRef]

48. Bridges, B. A. 1995. Are there DNA damage checkpoints in E. coli? BioEssays 17:63–70.[PubMed] [CrossRef]

49. Bridges, B. A., R. E. Dennis, and R. J. Munson. 1967. Differential induction and repair of ultraviolet damage leading to true reversions and external suppressor mutations of an ochre codon in Escherichia coli B/r WP2. Genetics 57:897–908.[PubMed]

50. Briggs, G. S., P. A. McEwan, J. Yu, T. Moore, J. Emsley, and R. G. Lloyd. 2007. Ring structure of the Escherichia coli DNA-binding protein RdgC associated with recombination and replication fork repair. J. Biol. Chem. 282:12353–12357.[PubMed] [CrossRef]

51. Britton, R. A., E. Kuster-Schock, T. A. Auchtung, and A. D. Grossman. 2007. SOS induction in a subpopulation of structural maintenance of chromosome (Smc) mutant cells in Bacillus subtilis. J. Bacteriol. 189:4359–4366.[PubMed] [CrossRef]

52. Brotcorne-Lannoye, A., and G. Maenhaut-Michel. 1986. Role of RecA protein in untargeted UV mutagenesis of bacteriophage λ: evidence for the requirement for the dinB gene. Proc. Natl. Acad. Sci. USA 83:3904–3908.[PubMed] [CrossRef]

53. Burckhardt, S. E., R. Woodgate, R. H. Scheuermann, and H. Echols. 1988. UmuD mutagenesis protein of Escherichia coli: overproduction, purification, and cleavage by RecA. Proc. Natl. Acad. Sci. USA 85:1811–1815.[PubMed] [CrossRef]

54. Cairns, J., and P. L. Foster. 1991. Adaptive reversion of a frameshift mutation in Escherichia coli. Genetics 128:695–701.[PubMed]

55. Calsou, P., and M. Defais. 1985. Weigle reactivation and mutagenesis of bacteriophage λ in lexA (Def) mutants of E. coli K12. Mol. Gen. Genet. 201:329–333.[PubMed] [CrossRef]

56. Calsou, P., A. Villaverde, and M. Defais. 1987. Activated RecA protein may induce expression of a gene that is not controlled by the LexA repressor and whose function is required for mutagenesis and repair of UV-irradiated bacteriophage lambda. J. Bacteriol. 169:4816–4821.[PubMed]

57. Campoy, S., M. Fontes, S. Padmanabhan, P. Cortes, M. Llagostera, and J. Barbe. 2003. LexA-independent DNA damage-mediated induction of gene expression in Myxococcus xanthus. Mol. Microbiol. 49:769–781.[PubMed] [CrossRef]

58. Campoy, S., N. Salvador, P. Cortes, I. Erill, and J. Barbe. 2005. Expression of canonical SOS genes is not under LexA repression in Bdellovibrio bacteriovorus. J. Bacteriol. 187:5367–5375.[PubMed] [CrossRef]

59. Casadaban, M. J., and S. N. Cohen. 1980. Lactose genes fused to exogenous promoters in one step using a Mu-lac bacteriophage: in vivo probe for transcriptional control sequences. Proc. Natl. Acad. Sci. USA 76:4530–4533. [CrossRef]

60. Casaregola, S., R. D'Ari, and O. Huisman. 1982. Quantitative evaluation of recA gene expression in Escherichia coli. Mol. Gen. Genet. 185:430–439.[PubMed] [CrossRef]

61. Castellazzi, M., J. George, and G. Buttin. 1972. Prophage induction and cell division in E. coli. I. Further characterization of the thermosensitive mutation tif-1 whose expression mimics the effects of UV irradiation. Mol. Gen. Genet. 119:139–152.[PubMed] [CrossRef]

62. Cayrol, C., C. Petit, B. Raynaud, J. Capdevielle, J. C. Guillemot, and M. Defais. 1995. Recovery of respiration following the SOS response of Escherichia coli requires RecA-mediated induction of 2-keto-4-hydroxyglutarate aldolase. Proc. Natl. Acad. Sci. USA 92:11806–11809.[PubMed] [CrossRef]

63. Chatterji, M., S. Sengupta, and V. Nagaraja. 2003. Chromosomally encoded gyrase inhibitor GyrI protects Escherichia coli against DNA-damaging agents. Arch. Microbiol. 180:339–346.[PubMed] [CrossRef]

64. Chedin, F., S. D. Ehrlich, and S. C. Kowalczykowski. 2000. The Bacillus subtilis AddAB helicase/nuclease is regulated by its cognate Chi sequence in vitro. J. Mol. Biol. 298:7–20.[PubMed] [CrossRef]

65. Chedin, F., N. Handa, M. S. Dillingham, and S. C. Kowalczykowski. 2006. The AddAB helicase/nuclease forms a stable complex with its cognate chi sequence during translocation. J. Biol. Chem. 281:18610–18617.[PubMed] [CrossRef]

66. Cheftel, J. C. 1995. High-pressure, microbial inactivation and food preservation. Food Sci. Technol. Int. 1:75–90. (In French.) [CrossRef]

67. Cirz, R. T., M. B. Jones, N. A. Gingles, T. D. Minogue, B. Jarrahi, S. N. Peterson, and F. E. Romesberg. 2007. Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J. Bacteriol. 189:531–539.[PubMed] [CrossRef]

68. Cirz, R. T., B. M. O'Neill, J. A. Hammond, S. R. Head, and F. E. Romesberg. 2006. Defining the Pseudomonas aeruginosa SOS response and its role in the global response to the antibiotic ciprofloxacin. J. Bacteriol. 188:7101–7110.[PubMed] [CrossRef]

69. Clark, A. J. 1982. RecA operator mutations and their usefulness. Biochimie 64:669–675.[PubMed] [CrossRef]

70. Cole, S. T. 1983. Characterization of the promoter for the LexA regulated sulA gene of Escherichia coli. Mol. Gen. Genet. 189:400–404.[PubMed] [CrossRef]

71. Cooper, S., and C. E. Helmstetter. 1968. Chromosome replication and the division cycle of Escherichia coli B/r. J. Mol. Biol. 31:519–540.[PubMed] [CrossRef]

72. Cordell, S. C., E. J. Robinson, and J. Lowe. 2003. Crystal structure of the SOS cell division inhibitor SulA and in complex with FtsZ. Proc. Natl. Acad. Sci. USA 100:7889–7894. [CrossRef]

73. Courcelle, J., J. R. Donaldson, K. H. Chow, and C. T. Courcelle. 2003. DNA damage-induced replication fork regression and processing in Escherichia coli. Science 299:1064–1067.[PubMed] [CrossRef]

74. Courcelle, J., and P. C. Hanawalt. 1999. RecQ and RecJ process blocked replication forks prior to the resumption of replication in UV-irradiated Escherichia coli. Mol. Gen. Genet. 262:543–551.[PubMed] [CrossRef]

75. Courcelle, J., A. Khodursky, B. Peter, P. O. Brown, and P. C. Hanawalt. 2001. Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics 158:41–64.[PubMed]

76. Cox, M. M. 2007. Regulation of bacterial RecA protein function. Crit. Rev. Biochem. Mol. Biol. 42:41–63.

77. Cox, M. M., and I. R. Lehman. 1982. RecA protein-promoted DNA strand exchange. Stable complexes of RecA protein and single-stranded DNA formed in the presence of ATP and single-stranded DNA binding protein. J. Biol. Chem. 257:8523–8532.[PubMed]

78. Craig, N. L., and J. W. Roberts. 1980. E. coli recA protein-directed cleavage of phage lambda repressor requires polynucleotide. Nature (London) 283:26–30.[PubMed] [CrossRef]

79. Craig, N. L., and J. W. Roberts. 1981. Function of nucleoside triphosphate and polynucleotide in Escherichia coli recA protein-directed cleavage of phage lambda repressor. J. Biol. Chem. 256:8039–8044.[PubMed]

80. D'Ari, R., and O. Huisman. 1982. DNA replication and indirect induction of the SOS response in Escherichia coli. Biochimie 64:623–627.[PubMed] [CrossRef]

81. D'Ari, R., and O. Huisman. 1983. Novel mechanism of cell division inhibition associated with the SOS response in Escherichia coli. J. Bacteriol. 156:243–250.[PubMed]

82. Dabbs, E. R. 1980. The gene for ribosomal protein S21, rpsU, maps close to dnaG at 66.5 min on the Escherichia coli chromosomal linkage map. J. Bacteriol. 144:603–607.[PubMed]

83. Daley, D. O., M. Rapp, E. Granseth, K. Melen, D. Drew, and G. von Heijne. 2005. Global topology analysis of the Escherichia coli inner membrane proteome. Science 308:1321–1323.[PubMed] [CrossRef]

84. Datta, S., N. Ganesh, N. R. Chandra, K. Muniyappa, and M. Vijayan. 2003. Structural studies on MtRecA-nucleotide complexes: insights into DNA and nucleotide binding and the structural signature of NTP recognition. Proteins 50:474–485.[PubMed] [CrossRef]

85. Datta, S., R. Krishna, N. Ganesh, N. R. Chandra, K. Muniyappa, and M. Vijayan. 2003. Crystal structures of Mycobacterium smegmatis RecA and its nucleotide complexes. J. Bacteriol. 185:4280–4284.[PubMed] [CrossRef]

86. Datta, S., M. M. Prabu, M. B. Vaze, N. Ganesh, N. R. Chandra, K. Muniyappa, and M. Vijayan. 2000. Crystal structures of Mycobacterium tuberculosis RecA and its complex with ADP-AlF(4): implications for decreased ATPase activity and molecular aggregation. Nucleic Acids Res. 28:4964–4973.[PubMed] [CrossRef]

87. Davis, E. O., B. Springer, K. K. Gopaul, K. G. Papavinasasundaram, P. Sander, and E. C. Bottger. 2002. DNA damage induction of recA in Mycobacterium tuberculosis independently of RecA and LexA. Mol. Microbiol. 46:791–800.[PubMed] [CrossRef]

88. Defais, M., P. Fauquet, M. Radman, and M. Errera. 1971. Ultraviolet reactivation and ultraviolet mutagenesis of lambda in different genetic systems. Virology 43:495–503.[PubMed] [CrossRef]

89. Devoret, R., and J. George. 1967. Induction indirecte du prophage lambda par le rayonnement ultraviolet. Mutat. Res. 4:713–714.[PubMed]

90. Devoret, R., M. Pierre, and P. L. Moreau. 1983. Prophage φ80 is induced in Escherichia coli K12 recA430. Mol. Gen. Genet. 189:199–206.[PubMed] [CrossRef]

91. DiCapua, E., M. Cuillel, E. Hewat, M. Schnarr, P. A. Timmins, and R. W. Ruigrok. 1992. Activation of recA protein. The open helix model for LexA cleavage. J. Mol. Biol. 226:707–719.[PubMed] [CrossRef]

92. Dillingham, M. S., M. Spies, and S. C. Kowalczykowski. 2003. RecBCD enzyme is a bipolar DNA helicase. Nature 423:893–897.[PubMed] [CrossRef]

93. Donachie, W. D. 1993. The cell cycle of Escherichia coli. Annu. Rev. Microbiol. 47:199–230.[PubMed] [CrossRef]

94. Donnelly, C. E., and G. C. Walker. 1992. Coexpression of UmuD' with UmuC suppresses the UV mutagenesis deficiency of groE mutants. J. Bacteriol. 174:3133–3139.[PubMed]

95. Donnelly, C. E., and G. C. Walker. 1989. groE mutants of Escherichia coli are defective in umuDC-dependent UV mutagenesis. J. Bacteriol. 171:6117–6125.[PubMed]

96. Dorazi, R., and S. J. Dewar. 2000. The SOS promoter dinH is essential for ftsK transcription during cell division. Microbiology 146(Pt 11):2891–2899.

97. Drees, J. C., S. Chitteni-Pattu, D. R. McCaslin, R. B. Inman, and M. M. Cox. 2006. Inhibition of RecA protein function by the RdgC protein from Escherichia coli. J. Biol. Chem. 281:4708–4717.[PubMed] [CrossRef]

98. Drees, J. C., S. L. Lusetti, S. Chitteni-Pattu, R. B. Inman, and M. M. Cox. 2004. A RecA filament capping mechanism for RecX protein. Mol. Cell 15:789–798.[PubMed] [CrossRef]

99. Drees, J. C., S. L. Lusetti, and M. M. Cox. 2004. Inhibition of RecA protein by the Escherichia coli RecX protein: modulation by the RecA C-terminus and filament functional state. J. Biol. Chem. 279:52991–52997.[PubMed] [CrossRef]

100. Dri, A.-M., and P. L. Moreau. 1994. Control of the LexA regulon by pH: evidence for a reversible inactivation of the LexA repressor during the growth cycle of Escherichia coli. Mol. Microbiol. 12:621–629.[PubMed] [CrossRef]

101. Drlica, K., E. C. Engle, and S. H. Manes. 1980. DNA gyrase on the bacterial chromosome: possibility of two levels of action. Proc. Natl. Acad. Sci. USA 77:6879–6883.[PubMed] [CrossRef]

102. Dronkert, M. L., and R. Kanaar. 2001. Repair of DNA interstrand cross-links. Mutat. Res. 486:217–247.[PubMed] [CrossRef]

103. Dutreix, M., A. Backman, J. Celerier, M. M. Bagdasarian, S. Sommer, A. Bailone, R. Devoret, and M. Bagdasarian. 1988. Identification of psiB genes of plasmids F and R6-5. Molecular basis for psiB enhanced expression in plasmid R6-5. Nucleic Acids Res. 16:10669–10679.[PubMed] [CrossRef]

104. Dutreix, M., B. Burnett, A. Bailone, C. M. Radding, and R. Devoret. 1992. A partially deficient mutant, recA1730, that fails to form normal nucleoprotein filaments. Mol. Gen. Genet. 232:489–497.[PubMed] [CrossRef]

105. Echols, H., and M. F. Goodman. 1991. Fidelity mechanisms in DNA replication. Annu. Rev. Biochem. 60:477–511.[PubMed] [CrossRef]

106. Egan, S. E., R. Fliege, S. Tong, A. Shibata, R. E. Wolf, Jr., and T. Conway. 1992. Molecular characterization of the Entner-Doudoroff pathway in Escherichia coli: sequence analysis and localization of promoters for the edd-eda operon. J. Bacteriol. 174:4638–4646.[PubMed]

107. Elledge, S. J., and G. C. Walker. 1983. Proteins required for ultraviolet light and chemical mutagenesis: identification of the products of the umuC locus of Escherichia coli. J. Mol. Biol. 164:175–192.[PubMed] [CrossRef]

108. Elliott, S. J., V. Sperandio, J. A. Giron, S. Shin, J. L. Mellies, L. Wainwright, S. W. Hutcheson, T. K. McDaniel, and J. B. Kaper. 2000. The locus of enterocyte effacement (LEE)-encoded regulator controls expression of both LEE- and non-LEE-encoded virulence factors in enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 68:6115–6126.[PubMed] [CrossRef]

109. Ennis, D. G., B. Fisher, S. Edmiston, and D. W. Mount. 1985. Dual role for Escherichia coli RecA protein in SOS mutagenesis. Proc. Natl. Acad. Sci. USA 82:3325–3329.[PubMed] [CrossRef]

110. Erill, I., S. Campoy, and J. Barbe. 2007. Aeons of distress: an evolutionary perspective on the bacterial SOS response. FEMS Microbiol. Rev. 31:637–656.[PubMed] [CrossRef]

111. Fath, M. J., H. K. Mahanty, and R. Kolter. 1989. Characterization of a purF operon mutation which affects colicin V production. J. Bacteriol. 171:3158–3161.[PubMed]

112. Ferentz, A. E., T. Opperman, G. C. Walker, and G. Wagner. 1997. Dimerization of the UmuD' protein in solution and its implications for regulation of SOS mutagenesis. Nat. Struct. Biol. 4:979–983.[PubMed] [CrossRef]

113. Fernandez De Henestrosa, A. R., T. Ogi, S. Aoyagi, D. Chafin, J. J. Hayes, H. Ohmori, and R. Woodgate. 2000. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol. Microbiol. 35:1560–1572.[PubMed] [CrossRef]

114. Finch, P. W., P. Chambers, and P. T. Emmerson. 1985. Identification of the E. coli recN gene product as a major SOS protein. J. Bacteriol. 164:653–658.[PubMed]

115. Fogliano, M., and P. F. Schendel. 1981. Evidence for the inducibility of the uvrB operon. Nature (London) 289:196–198.[PubMed] [CrossRef]

116. Foster, P. L. 2004. Adaptive mutation in Escherichia coli. J. Bacteriol. 186:4846–4852.[PubMed] [CrossRef]

117. Foster, P. L. 2004. Rebuttal: adaptive point mutation (Rosenberg and Hastings). J. Bacteriol. 186:4845. [CrossRef]

117a. Foster, P. L. 2007. Stress-induced mutagenesis in bacteria. Crit. Rev. Biochem. 42:373–397.[PubMed] [CrossRef]

118. Foti, J. J., N. S. Persky, D. J. Ferullo, and S. T. Lovett. 2007. Chromosome segregation control by Escherichia coli ObgE GTPase. Mol. Microbiol. 65:569–581.[PubMed] [CrossRef]

119. Foti, J. J., J. Schienda, V. A. Sutera, Jr., and S. T. Lovett. 2005. A bacterial G protein-mediated response to replication arrest. Mol. Cell 17:549–560.[PubMed] [CrossRef]

120. Friedberg, E. C., G. C. Walker, W. Siede, R. D. Wood, R. A. Schultz, and T. Ellenberger. 2005. DNA Repair and Mutagenesis, 2nd ed. ASM Press, Washington, DC.

121. Fuchs, J. A. 1977. Coordinate control of the synthesis of ribonucleoside diphosphate reductase components in Escherichia coli. J. Bacteriol. 130:957–959.[PubMed]

122. Fuchs, J. A., and H. O. Karlstrom. 1976. Mapping of nrdA and nrdB in Escherichia coli K-12. J. Bacteriol. 128:810–814.[PubMed]

123. Fuchs, J. A., and H. O. Karlstrom. 1973. A mutant of Escherichia coli defective in ribonucleosidediphosphate reductase. 2. Characterization of the enzymatic defect. Eur. J. Biochem. 32:457–462.[PubMed] [CrossRef]

124. Fuchs, J. A., H. O. Karlstrom, H. R. Warner, and P. Reichard. 1972. Defective gene product in dnaF mutant of Escherichia coli. Nat. New Biol. 238:69–71.[PubMed] [CrossRef]

125. Fuchs, J. A., and J. Neuhard. 1973. A mutant of Escherichia coli defective in ribonucleosidediphosphate reductase. 1. Isolation of the mutant as a deoxyuridine auxotroph. Eur. J. Biochem. 32:451–456.[PubMed] [CrossRef]

126. Fuchs, R. P., N. Koffel-Schwartz, S. Pelet, R. Janel-Bintz, R. Napolitano, O. J. Becherel, T. H. Broschard, D. Y. Burnouf, and J. Wagner. 2001. DNA polymerases II and V mediate respectively mutagenic (−2 frameshift) and error-free bypass of a single N-2-acetylaminofluorene adduct. Biochem. Soc. Trans. 29:191–195.[PubMed] [CrossRef]

127. Galletto, R., I. Amitani, R. J. Baskin, and S. C. Kowalczykowski. 2006. Direct observation of individual RecA filaments assembling on single DNA molecules. Nature 443:875–878.[PubMed] [CrossRef]

128. Ganesan, A. K., and P. C. Seawell. 1975. The effect of lexA and recF mutations on post-replication repair and DNA synthesis in Escherichia coli K-12. Mol. Gen. Genet. 141:189–205.[PubMed] [CrossRef]

129. Garcia-Graells, C., C. Valckx, and C. W. Michiels. 2000. Inactivation of Escherichia coli and Listeria innocua in milk by combined treatment with high hydrostatic pressure and the lactoperoxidase system. Appl. Environ. Microbiol. 66:4173–4179.[PubMed] [CrossRef]

130. Gardner, T. S., D. di Bernardo, D. Lorenz, and J. J. Collins. 2003. Inferring genetic networks and identifying compound mode of action via expression profiling. Science 301:102–105.[PubMed] [CrossRef]

131. Gellert, M., K. Mizuuchi, M. O'Dea, T. Itoh, and J.-I. Tomizawa. 1977. Nalidixic acid resistance: a second genetic character involved in DNA gyrase activity. Proc. Natl. Acad. Sci. USA 74:4772–4776.[PubMed] [CrossRef]

132. George, J., M. Castellazzi, and G. Buttin. 1975. Prophage induction and cell division in E.coli. III. Mutations sfiA and sfiB restore division in tif and lon strains and permit the expression of mutator properties of tif. Mol. Gen. Genet. 140:309–332.

133. George, J., R. Devoret, and M. Radman. 1974. Indirect ultraviolet-reactivation of phage lambda. Proc. Natl. Acad. Sci. USA 71:144–147.[PubMed] [CrossRef]

134. Georgiou, T., Y. N. Yu, S. Ekunwe, M. J. Buttner, A. Zuurmond, B. Kraal, C. Kleanthous, and L. Snyder. 1998. Specific peptide-activated proteolytic cleavage of Escherichia coli elongation factor Tu. Proc. Natl. Acad. Sci. USA 95:2891–2895.[PubMed] [CrossRef]

135. Gibert, I., S. Calero, and J. Barbe. 1990. Measurement of in vivo expression of nrdA and nrdB genes of Escherichia coli by using lacZ gene fusions. Mol. Gen. Genet. 220:400–408.[PubMed] [CrossRef]

136. Gitai, Z., M. Thanbichler, and L. Shapiro. 2005. The choreographed dynamics of bacterial chromosomes. Trends Microbiol. 13:221–228.[PubMed] [CrossRef]

137. Godoy, V. G., D. F. Jarosz, S. M. Simon, A. Abyzov, V. Ilyin, and G. C. Walker. 2007. UmuD and RecA directly modulate the mutagenic potential of the Y family DNA polymerase DinB. Mol. Cell 28:1058–1070.[PubMed] [CrossRef]

138. Godoy, V. G., D. F. Jarosz, F. L. Walker, L. A. Simmons, and G. C. Walker. 2006. Y-family DNA polymerases respond to DNA damage-independent inhibition of replication fork progression. EMBO J. 25:868–879.[PubMed] [CrossRef]

139. Goerke, C., J. Koller, and C. Wolz. 2006. Ciprofloxacin and trimethoprim cause phage induction and virulence modulation in Staphylococcus aureus. Antimicrob. Agents Chemother. 50:171–177.[PubMed] [CrossRef]

140. Goerlich, O., P. Quillardet, and M. Hofnung. 1989. Induction of the SOS response by hydrogen peroxide in various Escherichia coli mutants with altered protection against oxidative DNA damage. J. Bacteriol. 171:6141–6147.[PubMed]

141. Goldfless, S. J., A. S. Morag, K. A. Belisle, V. A. Sutera, Jr., and S. T. Lovett. 2006. DNA repeat rearrangements mediated by DnaK-dependent replication fork repair. Mol. Cell 21:595–604.[PubMed] [CrossRef]

142. Golub, E., A. Bailone, and R. Devoret. 1988. A gene encoding an SOS inhibitor is present in different conjugative plasmids. J. Bacteriol. 170:4392–4394.[PubMed]

143. Goranov, A. I., L. Katz, A. M. Breier, C. B. Burge, and A. D. Grossman. 2005. A transcriptional response to replication status mediated by the conserved bacterial replication protein DnaA. Proc. Natl. Acad. Sci. USA 102:12932–12937.[PubMed] [CrossRef]

144. Goranov, A. I., E. Kuester-Schoeck, J. D. Wang, and A. D. Grossman. 2006. Characterization of the global transcriptional responses to different types of DNA damage and disruption of replication in Bacillus subtilis. J. Bacteriol. 188:5595–5605.[PubMed] [CrossRef]

145. Grambow, N. J., N. K. Birkeland, D. L. Anders, and G. E. Christie. 1990. Deletion analysis of a bacteriophage P2 late promoter. Gene 95:9–15.[PubMed] [CrossRef]

146. Greenberg, J., J. Donch, and L. Berends. 1975. The dominance of exrB over exrB⁺. Genet. Res. 25:39–44.[PubMed] [CrossRef]

147. Griffith, J. D., L. D. Harris, and J. Register, III. 1984. Visualization of SSB-ssDNA complexes active in the assembly of stable RecA-DNA filaments. Cold Spring Harbor Symp. Quant. Biol. 49:553–559.[PubMed]

148. Gudas, L. J., and D. W. Mount. 1977. Identification of the recA(tif) gene product of Escherichia coli. Proc. Natl. Acad. Sci. USA 74:5280–5284.[PubMed] [CrossRef]

149. Gudas, L. J., and A. B. Pardee. 1975. Model for regulation of Escherichia coli DNA repair functions. Proc. Natl. Acad. Sci. USA 72:2330–2334.[PubMed] [CrossRef]

150. Hegde, S., S. J. Sandler, A. J. Clark, and M. V. Madiraju. 1995. recO and recR mutations delay induction of the SOS response in Escherichia coli. Mol. Gen. Genet. 246:254–258.[PubMed] [CrossRef]

151. Hegde, S. P., M. H. Qin, X. H. Li, M. A. Atkinson, A. J. Clark, M. Rajagopalan, and M. V. Madiraju. 1996. Interactions of RecF protein with RecO, RecR, and single-stranded DNA binding proteins reveal roles for the RecF-RecO-RecR complex in DNA repair and recombination. Proc. Natl. Acad. Sci. USA 93:14468–14473.[PubMed] [CrossRef]

152. Hendricks, E. C., H. Szerlong, T. Hill, and P. Kuempel. 2000. Cell division, guillotining of dimer chromosomes and SOS induction in resolution mutants (dif, xerC and xerD) of Escherichia coli. Mol. Microbiol. 36:973–981.[PubMed] [CrossRef]

153. Hersh, M. N., R. G. Ponder, P. J. Hastings, and S. M. Rosenberg. 2004. Adaptive mutation and amplification in Escherichia coli: two pathways of genome adaptation under stress. Res. Microbiol. 155:352–359.[PubMed] [CrossRef]

154. Hishida, T., Y. W. Han, T. Shibata, Y. Kubota, Y. Ishino, H. Iwasaki, and H. Shinagawa. 2004. Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 18:1886–1897.[PubMed] [CrossRef]

155. Hobbs, M. D., A. Sakai, and M. M. Cox. 2007. SSB protein limits RecOR binding onto single-stranded DNA. J. Biol. Chem. 282:11058–11067.[PubMed] [CrossRef]

156. Hochhut, B., J. W. Beaber, R. Woodgate, and M. K. Waldor. 2001. Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J. Bacteriol. 183:1124–1132.[PubMed] [CrossRef]

157. Horii, T., T. Ogawa, T. Nakatani, T. Hase, H. Matsubara, and H. Ogawa. 1981. Regulation of SOS functions: purification of E. coli LexA protein and determination of its specific site cleaved by the RecA protein. Cell 27:515–522.[PubMed] [CrossRef]

158. Horii, Z., and A. J. Clark. 1973. Genetic analysis of the recF pathway to genetic recombination in Escherichia coli K12: isolation and characterization of mutants. J. Mol. Biol. 80:327–344.[PubMed] [CrossRef]

159. Howard-Flanders, P., R. P. Boyce, and L. Theriot. 1964. Three loci in Escherichia coli that control the excision of pyrrimidne dimers and certain mutagenic products from DNA. Genetics 53:1119–1136.

160. Huisman, O., and R. D'Ari. 1981. An inducible DNA replication-cell division coupling mechanism in E. coli. Nature (London) 290:797–799.[PubMed] [CrossRef]

161. Hurstel, S., M. Granger-Schnarr, M. Daune, and M. Schnarr. 1986. In vitro binding of LexA repressor to DNA: evidence for the involvement of the amino-terminal domain. EMBO J. 5:793–798.[PubMed]

162. Hurstel, S., M. Granger-Schnarr, and M. Schnarr. 1988. Contacts between the LexA repressor—or its DNA binding domain—and the backbone of the recA operator. EMBO J. 7:269–275.[PubMed]

163. Ihara, M., K. Yamamato, and T. Ohnishi. 1987. Induction of phr gene expression by irradiation of ultraviolet light in Escherichia coli. Mol. Gen. Genet. 209:200–202.[PubMed] [CrossRef]

164. Imlay, J. A., and S. Linn. 1987. Mutagenesis and stress responses induced in Escherichia coli by hydrogen peroxide. J. Bacteriol. 169:2967–2976.[PubMed]

165. Irino, N., K. Nakayama, and H. Nakayama. 1986. The recQ gene of Escherichia coli K-12: primary structure and evidence for SOS regulation. Mol. Gen. Genet. 205:298–304.[PubMed] [CrossRef]

166. Iusupova, D. V., R. V. Sokolova, O. V. Porfir’eva, and A. Z. Ponomareva. 1991. Induction of intracellular endonuclease synthesis in Serratia marcescens by agents suppressing DNA replication. Mikrobiologiia 60:279–284.[PubMed]

167. Janion, C., A. Sikora, A. Nowosielska, and E. Grzesiuk. 2002. Induction of the SOS response in starved Escherichia coli. Environ. Mol. Mutagen. 40:129–133.[PubMed] [CrossRef]

168. Jarosz, D. F., P. J. Beuning, S. E. Cohen, and G. C. Walker. 2007. Y-family DNA polymerases in Escherichia coli. Trends Microbiol. 15:70–77.[PubMed] [CrossRef]

169. Jarosz, D. F., V. G. Godoy, J. C. Delaney, J. M. Essigmann, and G. C. Walker. 2006. A single amino acid governs enhanced activity of DinB DNA polymerases on damaged templates. Nature 439:225–228.[PubMed] [CrossRef]

170. Joo, C., S. A. McKinney, M. Nakamura, I. Rasnik, S. Myong, and T. Ha. 2006. Real-time observation of RecA filament dynamics with single monomer resolution. Cell 126:515–527.[PubMed] [CrossRef]

171. Kaasch, M., J. Kaasch, and A. Quinones. 1989. Expression of the dnaN and dnaQ genes of Escherichia coli is inducible by mitomycin. Mol. Gen. Genet. 219:187–192.[PubMed] [CrossRef]

172. Kano, Y., K. Osato, M. Wada, and F. Imamoto. 1987. Cloning and sequencing of the HU-2 gene of Escherichia coli. Mol. Gen. Genet. 209:408–410.[PubMed] [CrossRef]

173. Kano, Y., M. Wada, and F. Imamoto. 1988. Genetic characterization of the gene hupA encoding the HU-2 protein of Escherichia coli. Gene 69:331–335.[PubMed] [CrossRef]

174. Kano, Y., M. Wada, T. Nagase, and F. Imamoto. 1986. Genetic characterization of the gene hupB encoding the HU-1 protein of Escherichia coli. Gene 45:37–44.[PubMed] [CrossRef]

175. Kano, Y., S. Yoshino, M. Wada, K. Yokoyama, M. Nobuhara, and F. Imamoto. 1985. Molecular cloning and nucleotide sequence of the HU-1 gene of Escherichia coli. Mol. Gen. Genet. 201:360–362.[PubMed] [CrossRef]

176. Kanuri, M., L. V. Nechev, S. E. Kiehna, P. J. Tamura, C. M. Harris, T. M. Harris, and R. S. Lloyd. 2005. Evidence for Escherichia coli polymerase II mutagenic bypass of intrastrand DNA crosslinks. DNA Repair (Amst.) 4:1374–1380.[PubMed]

177. Karu, A. E., and E. D. Belk. 1982. Induction of E. coli recA protein via recBC and alternate pathways: quantitation by enzyme-linked immunosorbent assay (ELISA). Mol. Gen. Genet. 185:275–282.[PubMed] [CrossRef]

178. Kato, T., and Y. Shinoura. 1977. Isolation and characterization of mutants of Escherichia coli deficient in induction of mutations by ultraviolet light. Mol. Gen. Genet. 156:121–131.[PubMed]

179. Kawai, Y., S. Moriya, and N. Ogasawara. 2003. Identification of a protein, YneA, responsible for cell division suppression during the SOS response in Bacillus subtilis. Mol. Microbiol. 47:1113–1122.[PubMed] [CrossRef]

180. Kelley, W. L. 2006. Lex marks the spot: the virulent side of SOS and a closer look at the LexA regulon. Mol. Microbiol. 62:1228–1238.[PubMed] [CrossRef]

181. Kenyon, C. J., R. Brent, M. Ptashne, and G. C. Walker. 1982. Regulation of damage-inducible genes in Escherichia coli. J. Mol. Biol. 160:445–457.[PubMed] [CrossRef]

182. Kenyon, C. J., and G. C. Walker. 1980. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli. Proc. Natl. Acad. Sci. USA 77:2819–2823.[PubMed] [CrossRef]

183. Kenyon, C. J., and G. C. Walker. 1981. Expression of the E. coli uvrA gene is inducible. Nature (London) 289:808–810.[PubMed] [CrossRef]

184. Khil, P. P., and R. D. Camerini-Otero. 2002. Over 1000 genes are involved in the DNA damage response of Escherichia coli. Mol. Microbiol. 44:89–105.[PubMed] [CrossRef]

185. Kidane, D., and P. L. Graumann. 2005. Dynamic formation of RecA filaments at DNA double strand break repair centers in live cells. J. Cell Biol. 170:357–366.[PubMed] [CrossRef]

186. Kim, B., and J. W. Little. 1992. Dimerization of a specific DNA-binding protein on the DNA. Science 255:203–206.[PubMed] [CrossRef]

187. Kim, B., and J. W. Little. 1993. LexA and λ cI repressors as enzymes: specific cleavage in an intermolecular reaction. J. Bacteriol. 73:1165–1173.

188. Kim, S.-R., G. Maenhaut-Michel, M. Yamada, Y. Yamamoto, K. Matsui, T. Sofuni, T. Nohmi, and H. Ohmori. 1997. Multiple pathways for SOS-mutagenesis in Escherichia coli: an overexpression of dinB/dinP results in strongly enhancing mutagenesis in the absence of any exogenous treatment to damage DNA. Proc. Natl. Acad. Sci. USA 94:13792–12797.[PubMed] [CrossRef]

189. Kim, S. R., K. Matsui, M. Yamada, P. Gruz, and T. Nohmi. 2001. Roles of chromosomal and episomal dinB genes encoding DNA pol IV in targeted and untargeted mutagenesis in Escherichia coli. Mol. Genet. Genomics 266:207–215.[PubMed] [CrossRef]

190. Kitagawa, Y., E. Akaboshi, H. Shinagawa, T. Horii, H. Ogawa, and T. Kato. 1985. Structural analysis of the umu operon required for inducible mutagenesis in Escherichia coli. Proc. Natl. Acad. Sci. USA 82:4336–4340.[PubMed] [CrossRef]

191. Kleinsteuber, S., and A. Quinones. 1995. Expression of the dnaB gene of Escherichia coli is inducible by replication-blocking DNA damage in a recA-independent manner. Mol. Gen. Genet. 248:695–702.[PubMed] [CrossRef]

192. Knight, K. L., K. H. Aoki, E. L. Ujita, and K. McEntee. 1984. Identification of the amino acid substitutions in two mutant forms of the RecA protein from Escherichia coli RecA441 and Rec629. J. Biol. Chem. 259:11279–11283.[PubMed]

193. Kobayashi, H., M. Kaern, M. Araki, K. Chung, T. S. Gardner, C. R. Cantor, and J. J. Collins. 2004. Programmable cells: interfacing natural and engineered gene networks. Proc. Natl. Acad. Sci. USA 101:8414–8419.[PubMed] [CrossRef]

194. Koch, H. K., and R. Woodgate. 1998. The SOS response, p. 107–134. In J. A. Nickoloff and M. F. Hoekstra (ed.), DNA Damage and Repair, vol. 1. DNA Repair in Prokaryotes and Lower Eukaryotes. Humana Press, Totowa, NJ.

195. Koonin, E. V. 1993. Escherichia coli dinG gene encodes a putative DNA helicase related to a group of eukaryotic helicases including Rad3 protein. Nucleic Acids Res. 21:1497. [CrossRef]

196. Kow, Y. W., B. Imhoff, B. Weiss, D. C. Hung, A. A. Hindoyan, R. M. Story, and S. D. Goodman. 2007. Escherichia coli HU protein has a role in the repair of abasic sites in DNA. Nucleic Acids Res. 35:6672–6680.[PubMed] [CrossRef]

197. Kowalczykowski, S. C., and R. A. Krupp. 1987. Effects of Escherichia coli SSB protein on the single-stranded DNA-dependent ATPase activity of Escherichia coli RecA protein. Evidence that SSB protein facilitates the binding of RecA protein to regions of secondary structure within single-stranded DNA. J. Mol. Biol. 193:97–113.[PubMed] [CrossRef]

198. Krasin, F., and F. Hutchinson. 1977. Repair of DNA double-strand breaks in Escherichia coli, which requires RecA function and the presence of a duplicate genome. J. Mol. Biol. 116:81–98.[PubMed] [CrossRef]

199. Kuczynska-Wisnik, D., S. Kedzierska, E. Matuszewska, P. Lund, A. Taylor, B. Lipinska, and E. Laskowska. 2002. The Escherichia coli small heat-shock proteins IbpA and IbpB prevent the aggregation of endogenous proteins denatured in vivo during extreme heat shock. Microbiology 148:1757–1765.[PubMed]

200. Lau, I. F., S. R. Filipe, B. Soballe, O. A. Okstad, F. X. Barre, and D. J. Sherratt. 2003. Spatial and temporal organization of replicating Escherichia coli chromosomes. Mol. Microbiol. 49:731–743.[PubMed] [CrossRef]

201. Lavery, P. E., and S. C. Kowalczykowski. 1992. Biochemical basis of the constitutive repressor cleavage activity of recA730 protein. J. Biol. Chem. 29:20648–20658.

202. Lavery, P. E., and S. C. Kowalczykowski. 1990. Properties of recA441 protein-catalyzed DNA strand exchange can be attributed to an enhanced ability to compete with SSB protein. J. Biol. Chem. 265:4004–4010.[PubMed]

203. Layton, J. C., and P. L. Foster. 2003. Error-prone DNA polymerase IV is controlled by the stress-response sigma factor, RpoS, in Escherichia coli. Mol. Microbiol. 50:549–561.[PubMed] [CrossRef]

204. LeBowitz, J. H., and R. McMacken. 1986. The Escherichia coli dnaB replication protein is a DNA helicase. J. Biol. Chem. 261:4738–4748.[PubMed]

205. Lee, J. H., J. C. Wendt, and K. T. Shanmugam. 1990. Identification of a new gene, molR, essential for utilization of molybdate by Escherichia coli. J. Bacteriol. 172:2079–2087.[PubMed]

206. Lewis, L. K., G. R. Harlow, L. A. Gregg-Jolly, and D. W. Mount. 1994. Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J. Mol. Biol. 241:507–523.[PubMed] [CrossRef]

207. Lewis, L. K., M. E. Jenkins, and D. W. Mount. 1992. Isolation of DNA-damage inducible promoters in E. coli: regulation of polB (dinA), dinG, and dinH by LexA repressor. J. Bacteriol. 174:3377–3385.[PubMed]

208. Lifsics, M. R., E. D. Lancy, Jr., and R. Maurer. 1992. DNA replication defect in Salmonella typhimurium mutants lacking the editing (ε) subunit of DNA polymerase III. J. Bacteriol. 174:6965–6973.[PubMed]

209. Lin, L., and J. W. Little. 1989. Autodigestion and RecA-dependent cleavage of Ind− mutant LexA proteins. J. Mol. Biol. 210:439–452.[PubMed] [CrossRef]

210. Lin, L. L., and J. W. Little. 1988. Isolation and characterization of noncleavable (Ind^-) mutants of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 170:2163–2173.[PubMed]

211. Little, J. 1991. Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease. Biochimie 73:411–422.[PubMed] [CrossRef]

212. Little, J. W. 1983. The SOS regulatory system: control of its state by the level of recA protease. J. Mol. Biol. 167:791–808.[PubMed] [CrossRef]

213. Little, J. W., S. H. Edmiston, Z. Pacelli, and D. W. Mount. 1980. Cleavage of the Escherichia coli lexA protein by the recA protease. Proc. Natl. Acad. Sci. USA 77:3225–3229.[PubMed] [CrossRef]

214. Little, J. W., and J. E. Harper. 1979. Identification of the lexA gene product of Escherichia coli. Proc. Natl. Acad. Sci. USA 76:6147–6151.[PubMed] [CrossRef]

215. Little, J. W., B. Kim, K. L. Roland, M. H. Smith, L. L. Lin, and S. N. Slilaty. 1994. Cleavage of LexA repressor. Methods Enzymol. 244:266–284.[PubMed] [CrossRef]

216. Little, J. W., and D. G. Kleid. 1977. Escherichia coli protein X is the recA gene product. J. Biol. Chem. 252:6251–6252.[PubMed]

217. Little, J. W., and D. W. Mount. 1982. The SOS regulatory system of Escherichia coli. Cell 29:11–22.[PubMed] [CrossRef]

218. Little, J. W., D. W. Mount, and C. R. Yanisch-Perron. 1981. Purified lexA protein is a repressor of the recA and lexA genes. Proc. Natl. Acad. Sci. USA 78:4199–4203.[PubMed] [CrossRef]

219. Liu, G., G. C. Draper, and W. D. Donachie. 1998. FtsK is a bifunctional protein involved in cell division and chromosomal localization. Mol. Microbiol. 29:893–903.[PubMed] [CrossRef]

220. Liu, S.-K., and I. Tessman. 1990. Error-prone SOS repair can be error-free. J. Mol. Biol. 216:803–807.[PubMed] [CrossRef]

221. Livneh, Z., O. Cohen-Fix, R. Skaliter, and T. Elizur. 1993. Replication of damaged DNA and the molecular mechanism of ultraviolet light mutagenesis. CRC Crit. Rev. Biochem. Mol. Biol. 28:465–513.[PubMed] [CrossRef]

222. Lloyd, R. G., S. M. Picksley, and C. Prescott. 1983. Inducible expression of a gene specific to the recF pathway for recombination in Escherichia coli K12. Mol. Gen. Genet. 190:162–167.[PubMed] [CrossRef]

223. Lobner-Olesen, A., M. G. Marinus, and F. G. Hansen. 2003. Role of SeqA and Dam in Escherichia coli gene expression: a global/microarray analysis. Proc. Natl. Acad. Sci. USA 100:4672–4677.[PubMed] [CrossRef]

224. Lobrich, M., and P. A. Jeggo. 2007. The impact of a negligent G2/M checkpoint on genomic instability and cancer induction. Nat. Rev. Cancer 7:861–869.[PubMed] [CrossRef]

225. Lomba, M. R., A. T. Vasconcelos, A. B. Pacheco, and D. F. de Almeida. 1997. Identification of yebG as a DNA damage-inducible Escherichia coli gene. FEMS Microbiol. Lett. 156:119–122.[PubMed] [CrossRef]

226. Lombardo, M. J., I. Aponyi, and S. M. Rosenberg. 2004. General stress response regulator RpoS in adaptive mutation and amplification in Escherichia coli. Genetics 166:669–680.[PubMed] [CrossRef]

227. Luo, Y., R. A. Pfuetzner, S. Mosimann, M. Paetzel, E. A. Frey, M. Cherney, B. Kim, J. W. Little, and N. C. J. Strynadka. 2001. Crystal structure of LexA: a conformational switch for regulation of self-cleavage. Mol. Cell 106:585–594.[PubMed]

228. Lusetti, S. L., M. D. Hobbs, E. A. Stohl, S. Chitteni-Pattu, R. B. Inman, H. S. Seifert, and M. M. Cox. 2006. The RecF protein antagonizes RecX function via direct interaction. Mol. Cell 21:41–50.[PubMed] [CrossRef]

229. Madiraju, M. V., and A. J. Clark. 1990. Use of recA803, a partial suppressor of recF, to analyze the effects of the mutant ssb (single-stranded DNA-binding) proteins in vivo and in vitro. Mol. Gen. Genet. 224:129–135.[PubMed] [CrossRef]

230. Madiraju, M. V., P. E. Lavery, S. C. Kowalczykowski, and A. J. Clark. 1992. Enzymatic properties of the RecA803 protein, a partial suppressor of recF mutations. Biochemistry 31:10529–10535.[PubMed] [CrossRef]

231. Madiraju, M. V., A. Templin, and A. J. Clark. 1988. Properties of a mutant recA-encoded protein reveal a possible role for Escherichia coli recF-encoded protein in genetic recombination. Proc. Natl Acad. Sci. USA 85:6592–6596.[PubMed] [CrossRef]

232. Maiques, E., C. Ubeda, S. Campoy, N. Salvador, I. Lasa, R. P. Novick, J. Barbe, and J. R. Penades. 2006. Beta-lactam antibiotics induce the SOS response and horizontal transfer of virulence factors in Staphylococcus aureus. J. Bacteriol. 188:2726–2729.[PubMed] [CrossRef]

233. Maiques, E., C. Ubeda, M. A. Tormo, M. D. Ferrer, I. Lasa, R. P. Novick, and J. R. Penades. 2007. Role of staphylococcal phage and SaPI integrase in intra- and interspecies SaPI transfer. J. Bacteriol. 189:5608–5616.[PubMed] [CrossRef]

234. Maples, V. F., and S. R. Kushner. 1982. DNA repair in Escherichia coli: identification of the uvrD gene product. Proc. Natl. Acad. Sci. USA 79:5616–5620.[PubMed] [CrossRef]

235. Margolin, W. 2001. Spatial regulation of cytokinesis in bacteria. Curr. Opin. Microbiol. 4:647–652.[PubMed] [CrossRef]

236. Marsh, L., T. Nohmi, S. Hinton, and G. C. Walker. 1991. New mutations in cloned Escherichia coli umuDC genes: novel phenotypes of strains carrying a umuC125 plasmid. Mutat. Res. 250:183–197.[PubMed]

237. Marsh, L., and G. C. Walker. 1985. Cold sensitivity induced by overproduction of UmuDC in Escherichia coli. J. Bacteriol. 162:155–161.[PubMed]

238. McCool, J. D., E. Long, J. F. Petrosino, H. A. Sandler, S. M. Rosenberg, and S. J. Sandler. 2004. Measurement of SOS expression in individual Escherichia coli K-12 cells using fluorescence microscopy. Mol. Microbiol. 53:1343–1357.[PubMed] [CrossRef]

239. McGrew, D. A., and K. L. Knight. 2003. Molecular design and functional organization of the RecA protein. Crit. Rev. Biochem. Mol. Biol. 38:385–432.[PubMed] [CrossRef]

240. McKenzie, G. J., R. S. Harris, P. L. Lee, and S. M. Rosenberg. 2000. The SOS response regulates adaptive mutation. Proc. Natl. Acad. Sci. USA 97:6646–6651.[PubMed] [CrossRef]

241. McNally, K. P., N. E. Freitag, and G. C. Walker. 1990. LexA independent expression of a mutant mucAB operon. J. Bacteriol. 172:6223–6231.[PubMed]

242. Meddows, T. R., A. P. Savory, J. I. Grove, T. Moore, and R. G. Lloyd. 2005. RecN protein and transcription factor DksA combine to promote faithful recombinational repair of DNA double-strand breaks. Mol. Microbiol. 57:97–110.[PubMed] [CrossRef]

243. Mellies, J. L., K. R. Haack, and D. C. Galligan. 2007. SOS regulation of the type III secretion system of enteropathogenic Escherichia coli. J. Bacteriol. 189:2863–2872.[PubMed] [CrossRef]

244. Menetski, J. P., and S. C. Kowalczykowski. 1990. Biochemical properties of the Escherichia coli recA430 protein. Analysis of a mutation that affects the interaction of the ATP-recA protein complex with single-stranded DNA. J. Mol. Biol. 211:845–855.[PubMed] [CrossRef]

245. Meyer, R. R., J. Glassberg, and A. Kornberg. 1979. An Escherichia coli mutant defective in single-stranded binding protein is defective in DNA replication. Proc. Natl. Acad. Sci. USA 76:1702–1705.[PubMed] [CrossRef]

246. Miller, C., H. Ingmer, L. E. Thomsen, K. Skarstad, and S. N. Cohen. 2003. DpiA binding to the replication origin of Escherichia coli plasmids and chromosomes destabilizes plasmid inheritance and induces the bacterial SOS response. J. Bacteriol. 185:6025–6031.[PubMed] [CrossRef]

247. Miller, C., L. E. Thomsen, C. Gaggero, R. Mosseri, H. Ingmer, and S. N. Cohen. 2004. SOS response induction by beta-lactams and bacterial defense against antibiotic lethality. Science 305:1629–1631.[PubMed] [CrossRef]

248. Miller, H. I., and D. I. Friedman. 1980. An E. coli gene product required for lambda site-specific recombination. Cell 20:711–719.[PubMed] [CrossRef]

249. Miller, H. I., A. Kikuchi, H. A. Nash, R. A. Weisberg, and D. I. Friedman. 1979. Site-specific recombination of bacteriophage lambda: the role of host gene products. Cold Spring Harbor Symp. Quant. Biol. 43(Pt 2):1121–1126.

250. Miller, H. I., M. Kirk, and H. Echols. 1981. SOS induction and autoregulation of the himA gene for site-specific recombination in E. coli. Proc. Natl. Acad. Sci. USA 78:6754–6758.[PubMed] [CrossRef]

251. Miller, H. I., and H. A. Nash. 1981. Direct role of the himA gene product in phage integration. Nature (London) 290:523–526.[PubMed] [CrossRef]

252. Miyabe, I., Q. M. Zhang, Y. Kano, and S. Yonei. 2000. Histone-like protein HU is required for recA gene-dependent DNA repair and SOS induction pathways in UV-irradiated Escherichia coli. Int. J. Radiat. Biol. 76:43–49.[PubMed] [CrossRef]

253. Mohana-Borges, R., A. B. Pacheco, F. J. Sousa, D. Foguel, D. F. Almeida, and J. L. Silva. 2000. LexA repressor forms stable dimers in solution. The role of specific DNA in tightening protein-protein interactions. J. Biol. Chem. 275:4708–4712.[PubMed] [CrossRef]

254. Moolenaar, G. F., S. van Rossum-Fikkert, M. van Kesteren, and N. Goosen. 2002. Cho, a second endonuclease involved in Escherichia coli nucleotide excision repair. Proc. Natl. Acad. Sci. USA 99:1467–1472.[PubMed] [CrossRef]

255. Moore, T., P. McGlynn, H. P. Ngo, G. J. Sharples, and R. G. Lloyd. 2003. The RdgC protein of Escherichia coli binds DNA and counters a toxic effect of RecFOR in strains lacking the replication restart protein PriA. EMBO J. 22:735–745.[PubMed] [CrossRef]

256. Morimatsu, K., and S. C. Kowalczykowski. 2003. RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange. A universal step of recombinational repair. Mol. Cell 11:1337–1347.[PubMed] [CrossRef]

257. Mount, D. W. 1971. Isolation and genetic analysis of a strain of Escherichia coli K-12 with an amber recA mutation. J. Bacteriol. 107:388–389.[PubMed]

258. Mount, D. W., K. B. Low, and S. Edmiston. 1972. Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet light-induced mutations. J. Bacteriol. 112:886–893.[PubMed]

259. Mount, D. W., A. C. Walker, and C. Kosel. 1973. Suppression of lex mutations affecting deoxyribonucleic acid repair in Escherichia coli K-12 by closely linked thermosensitive mutations. J. Bacteriol. 116:950–956.[PubMed]

260. Mukherjee, A., C. Cao, and J. Lutkenhaus. 1998. Inhibition of FtsZ polymerization by SulA, an inhibitor of septation in Escherichia coli. Proc. Natl. Acad. Sci. USA 95:2885–2890.[PubMed] [CrossRef]

261. Munoz, M., B. de Ancos, C. Sanchez-Moreno, and M. P. Cano. 2007. Effects of high pressure and mild heat on endogenous microflora and on the inactivation and sublethal injury of Escherichia coli inoculated into fruit juices and vegetable soup. J. Food Prot. 70:1587–1593.[PubMed]

262. Murli, S., and G. C. Walker. 1993. SOS mutagenesis. Curr. Opin. Genet. Dev. 3:719–725.[PubMed] [CrossRef]

263. Nakamura, Y., T. Osawa, and T. Yura. 1977. Chromosomal location of a structural gene for the RNA polymerase sigma factor in Escherichia coli. Proc. Natl. Acad. Sci. USA 74:1831–1835.[PubMed] [CrossRef]

264. Nakanishi, A., T. Oshida, T. Matsushita, S. Imajoh-Ohmi, and T. Ohnuki. 1998. Identification of DNA gyrase inhibitor (GyrI) in Escherichia coli. J. Biol. Chem. 273:1933–1938.[PubMed] [CrossRef]

265. Napolitano, R., R. Janel-Bintz, J. Wagner, and R. P. Fuchs. 2000. All three SOS-inducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced mutagenesis. EMBO J. 19:6259–6265.[PubMed] [CrossRef]

266. Napolitano, R. L., I. B. Lambert, and R. P. P. Fuchs. 1997. SOS factors involved in translesion synthesis. Proc. Natl. Acad. Sci. USA 94:5733–5738.[PubMed] [CrossRef]

267. Ndjonka, D., and C. E. Bell. 2006. Structure of a hyper-cleavable monomeric fragment of phage lambda repressor containing the cleavage site region. J. Mol. Biol. 362:479–489.[PubMed] [CrossRef]

268. Neher, S. B., J. M. Flynn, R. T. Sauer, and T. A. Baker. 2003. Latent ClpX-recognition signals ensure LexA destruction after DNA damage. Genes Dev. 17:1084–1089.[PubMed] [CrossRef]

269. Nohmi, T., J. R. Battista, L. A. Dodson, and G. C. Walker. 1988. RecA-mediated cleavage activates UmuD for mutagenesis: mechanistic relationship between transcriptional derepression and posttranslational activation. Proc. Natl. Acad. Sci. USA 85:1816–1820.[PubMed] [CrossRef]

270. Nunoshiba, T., and H. Nishioka. 1991. ‘Rec-lac test’ for detecting SOS-inducing activity of environmental genotoxic substance. Mutat. Res. 254:71–77.[PubMed] [CrossRef]

271. Nurse, P., K. Zavitz, and K. Marians. 1991. Inactivation of the Escherichia coli PriA DNA replication protein induces the SOS response. J. Bacteriol. 173:6686–6693.[PubMed]

272. Oeda, K., T. Horiuchi, and M. Sekiguchi. 1982. The uvrD gene of E. coli encodes a DNA-dependent ATPase. Nature (London) 298:98–100.[PubMed] [CrossRef]

273. Opperman, T., S. Murli, B. T. Smith, and G. C. Walker. 1999. A model for a umuDC-dependent prokaryotic DNA damage checkpoint. Proc. Natl. Acad. Sci. USA 96:9218–9223.[PubMed] [CrossRef]

274. Opperman, T., S. Murli, and G. C. Walker. 1996. The genetic requirements for UmuDC-mediated cold sensitivity are distinct from those for SOS mutagenesis. J. Bacteriol. 178:4400–4411.[PubMed]

275. Ossanna, N., and D. W. Mount. 1989. Mutations in uvrD induce the SOS response in Escherichia coli. J. Bacteriol. 171:303–307.[PubMed]

276. Padan, E., and S. Schuldiner. 1986. Intracellular pH regulation in bacterial cells. Methods Enzymol. 125:337–352.[PubMed] [CrossRef]

277. Padan, E., D. Zilberstein, and H. Rottenberg. 1976. The proton electrochemical gradient in Escherichia coli cells. Eur. J. Biochem. 63:533–541.[PubMed] [CrossRef]

278. Pages, V., N. Koffel-Schwartz, and R. P. Fuchs. 2003. recX, a new SOS gene that is co-transcribed with the recA gene in Escherichia coli. DNA Repair (Amst.) 2:273–284.[PubMed] [CrossRef]

279. Papavinasasundaram, K. G., C. Anderson, P. C. Brooks, N. A. Thomas, F. Movahedzadeh, P. J. Jenner, M. J. Colston, and E. O. Davis. 2001. Slow induction of RecA by DNA damage in Mycobacterium tuberculosis. Microbiology 147:3271–3279.[PubMed]

280. Papavinasasundaram, K. G., F. Movahedzadeh, J. T. Keer, N. G. Stoker, M. J. Colston, and E. O. Davis. 1997. Mycobacterial recA is cotranscribed with a potential regulatory gene called recX. Mol. Microbiol. 24:141–153.[PubMed] [CrossRef]

281. Patil, R. V., and E. E. Dekker. 1992. Cloning, nucleotide sequence, overexpression, and inactivation of the Escherichia coli 2-keto-4-hydroxyglutarate aldolase gene. J. Bacteriol. 174:102–107.[PubMed]

282. Patterson, M. F., and D. J. Kilpatrick. 1998. The combined effect of high hydrostatic pressure and mild heat on inactivation of pathogens in milk and poultry. J. Food Prot. 61:432–436.[PubMed]

283. Payne, N., and A. Sancar. 1989. The LexA protein does not bind specifically to the two SOS box-like sequences immediately 5' to the phr gene. Mutat. Res. 218:207–210.[PubMed] [CrossRef]

284. Peat, T. S., E. G. Frank, J. P. McDonald, A. S. Levine, R. Woodgate, and W. A. Hendrickson. 1996. Structure of the UmuD' protein and its regulation in response to DNA damage. Nature 380:727–730.[PubMed] [CrossRef]

285. Pennington, J. M., and S. M. Rosenberg. 2007. Spontaneous DNA breakage in single living Escherichia coli cells. Nat. Genet. 39:797–802.[PubMed] [CrossRef]

286. Perry, K. L., S. J. Elledge, B. Mitchell, L. Marsh, and G. C. Walker. 1985. umuDC and mucAB operons whose products are required for UV light- and chemical-induced mutagenesis: UmuD, MucA, and LexA proteins share homology. Proc. Natl. Acad. Sci. USA 82:4331–4335.[PubMed] [CrossRef]

287. Peterson, K. R., and D. W. Mount. 1993. Analysis of the genetic requirements for viability of Escherichia coli K-12 DNA adenine methylase (dam) mutants. J. Bacteriol. 175:7505–758.[PubMed]

288. Petit, C., C. Cayrol, C. Lesca, P. Kaiser, C. Thompson, and M. Defais. 1993. Characterization of dinY, a new Escherichia coli DNA repair gene whose products are damage inducible even in a lexA(Def) background. J. Bacteriol. 175:642–646.[PubMed]

289. Pham, P., E. M. Seitz, S. Saveliev, X. Shen, R. Woodgate, M. M. Cox, and M. F. Goodman. 2002. Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis. Proc. Natl. Acad. Sci. USA 99:11061–11066.[PubMed] [CrossRef]

290. Picksley, S. M., P. V. Attfield, and R. G. Lloyd. 1984. Repair of double-strand breaks in Escherichia coli requires a functional recN gene product. Mol. Gen. Genet. 195:267–274.[PubMed] [CrossRef]

291. Picksley, S. M., S. J. Morton, and R. G. Lloyd. 1985. The recN locus of Escherichia coli K12: molecular analysis and identification of the gene product. Mol. Gen. Genet. 201:301–307.[PubMed] [CrossRef]

292. Prasad, T. K., C. C. Yeykal, and E. C. Greene. 2006. Visualizing the assembly of human Rad51 filaments on double-stranded DNA. J. Mol. Biol. 363:713–728.[PubMed] [CrossRef]

293. Prieto-Alamo, M. J., J. Jurado, R. Gallardo-Madueno, F. Monje-Casas, A. Holmgren, and C. Pueyo. 2000. Transcriptional regulation of glutaredoxin and thioredoxin pathways and related enzymes in response to oxidative stress. J. Biol. Chem. 275:13398–13405.[PubMed] [CrossRef]

294. Qiu, Z., and M. F. Goodman. 1997. The Escherichia coli polB locus is identical to dinA, the structural gene for DNA polymerase II. Characterization of Pol II purified from a polB mutant. J. Biol. Chem. 272:8611–8617.[PubMed] [CrossRef]

295. Quillardet, P., O. Huisman, R. D’Ari, and M. Hofnung. 1982. SOS chromotest, a direct assay of induction of an SOS function in Escherichia coli K-12 to measure genotoxicity. Proc. Natl. Acad. Sci. USA 79:5971–5975.[PubMed] [CrossRef]

296. Quillardet, P., M. A. Rouffaud, and P. Bouige. 2003. DNA array analysis of gene expression in response to UV irradiation in Escherichia coli. Res. Microbiol. 154:559–572.[PubMed] [CrossRef]

297. Quinones, A., W. Juterbock, and W. Messer. 1991. Expression of the dnaA gene of Escherichia coli is inducible by DNA damage. Mol. Gen. Genet. 227:9–16.[PubMed] [CrossRef]

298. Quinones, M., H. H. Kimsey, W. Ross, R. L. Gourse, and M. K. Waldor. 2006. LexA represses CTXphi transcription by blocking access of the alpha C-terminal domain of RNA polymerase to promoter DNA. J. Biol. Chem. 281:39407–39412.[PubMed] [CrossRef]

299. Quinones, M., H. H. Kimsey, and M. K. Waldor. 2005. LexA cleavage is required for CTX prophage induction. Mol. Cell 17:291–300.[PubMed] [CrossRef]

300. Radman, M. 1974. Phenomenology of an inducible mutagenic DNA repair pathway in Escherichia coli: SOS repair hypothesis, p. 128–142. In L. Prakash, F. Sherman, M. Miller, C. Lawrence, and H. W. Tabor (ed.), Molecular and Environmental Aspects of Mutagenesis. Charles C Thomas, Springfield, IL.

301. Rai, R., G. Peng, K. Li, and S. Y. Lin. 2007. DNA damage response: the players, the network and the role in tumor suppression. Cancer Genomics Proteomics 4:99–106.[PubMed]

302. Rand, L., J. Hinds, B. Springer, P. Sander, R. S. Buxton, and E. O. Davis. 2003. The majority of inducible DNA repair genes in Mycobacterium tuberculosis are induced independently of RecA. Mol. Microbiol. 50:1031–1042.[PubMed] [CrossRef]

303. Rangarajan, S., G. Gudmundsson, Z. Qiu, P. L. Foster, and M. F. Goodman. 1997. Escherichia coli DNA polymerase II catalyzes chromosomal and episomal DNA synthesis in vivo. Proc. Natl. Acad. Sci. USA 94:946–951.[PubMed] [CrossRef]

304. Rangarajan, S., R. Woodgate, and M. F. Goodman. 1999. A phenotype for enigmatic DNA polymerase II: a pivotal role for pol II in replication restart in UV-irradiated Escherichia coli. Proc. Natl. Acad. Sci. USA 96:9224–9229.[PubMed] [CrossRef]

305. Rangarajan, S., R. Woodgate, and M. F. Goodman. 2002. Replication restart in UV-irradiated Escherichia coli involving pols II, III, V, PriA, RecA and RecFOR proteins. Mol. Microbiol. 43:617–628.[PubMed] [CrossRef]

306. Relan, N. K., E. S. Jenuwine, O. H. Gumbs, and S. L. Shaner. 1997. Preferential interactions of the Escherichia coli LexA repressor with anions and protons are coupled to binding the recA operator. Biochemistry 36:1077–1184.[PubMed] [CrossRef]

307. Renzette, N., N. Gumlaw, J. T. Nordman, M. Krieger, S. P. Yeh, E. Long, R. Centore, R. Boonsombat, and S. J. Sandler. 2005. Localization of RecA in Escherichia coli K-12 using RecA-GFP. Mol. Microbiol. 57:1074–1085.[PubMed] [CrossRef]

308. Renzette, N., N. Gumlaw, and S. J. Sandler. 2007. DinI and RecX modulate RecA-DNA structures in Escherichia coli K-12. Mol. Microbiol. 63:103–115.[PubMed] [CrossRef]

309. Roberts, J. W., and C. W. Roberts. 1975. Proteolytic cleavage of bacteriophage lambda repressor in induction. Proc. Natl. Acad. Sci. USA 72:147–151.[PubMed] [CrossRef]

310. Rohrwild, M., O. Coux, H. C. Huang, R. P. Moerschell, S. J. Yoo, J. H. Seol, C. H. Chung, and A. L. Goldberg. 1996. HslV-HslU: a novel ATP-dependent protease complex in Escherichia coli related to the eukaryotic proteasome. Proc. Natl. Acad. Sci. USA 93:5808–5813.[PubMed] [CrossRef]

311. Roland, K. L., and J. W. Little. 1990. Reaction of LexA repressor with diisopropylfluorophosphate: a test of the serine protease model. J. Biol. Chem. 265:12828–12835.[PubMed]

312. Roland, K. L., M. H. Smith, J. A. Rupley, and J. W. Little. 1992. In vitro analysis of mutant LexA proteins with an increased rate of specific cleavage. J. Mol. Biol. 228:395–408.[PubMed] [CrossRef]

313. Rolfes, R. J., and H. Zalkin. 1988. Escherichia coli gene purR encoding a repressor protein for purine nucleotide synthesis. Cloning, nucleotide sequence, and interaction with the purF operator. J. Biol. Chem. 263:19653–19661.[PubMed]

314. Rolfes, R. J., and H. Zalkin. 1988. Regulation of Escherichia coli purF. Mutations that define the promoter, operator, and purine repressor gene. J. Biol. Chem. 263:19649–19652.[PubMed]

315. Rosenberg, S. M. 2001. Evolving responsively: adaptive mutation. Nat. Rev. Genet. 2:504–515.[PubMed] [CrossRef]

316. Rosenberg, S. M., and P. J. Hastings. 2004. Rebuttal: adaptive mutation in Escherichia coli (Foster). J. Bacteriol. 186:4853. [CrossRef]

317. Rosner, J. L., L. R. Kass, and M. B. Yarmolinksy. 1968. Parallel behavior of F and Pl in causing indirect induction of lysogenic bacteria. Cold Spring Harbor Symp. Quant. Biol. 33:785–789.[PubMed]

318. Roth, J. R., and D. I. Andersson. 2004. Rebuttal: adaptive point mutation (Rosenberg and Hastings). J. Bacteriol. 186:4844. [CrossRef]

319. Rothfield, L., A. Taghbalout, and Y. L. Shih. 2005. Spatial control of bacterial division-site placement. Nat. Rev. Microbiol. 3:959–968.[PubMed] [CrossRef]

320. Rothman, R. H., and A. J. Clark. 1977. Defective excision and postreplication repair of UV-damaged DNA in a recL mutant strain of E. coli K-12. Mol. Gen. Genet. 155:267–277.[PubMed] [CrossRef]

321. Rothman, R. H., and A. J. Clark. 1977. The dependence of postreplication repair on uvrB in a recF mutant of Escherichia coli K-12. Mol. Gen. Genet. 155:279–286.[PubMed] [CrossRef]

322. Ryan, K. R., and L. Shapiro. 2003. Temporal and spatial regulation in prokaryotic cell cycle progression and development. Annu. Rev. Biochem. 72:367–394.[PubMed] [CrossRef]

323. Ryder, L., G. J. Sharples, and R. G. Lloyd. 1996. Recombination-dependent growth in exonuclease-depleted recBC sbcBC strains of Escherichia coli K-12. Genetics 143:1101–1114.[PubMed]

324. Salles, B., and M. Defais. 1984. Signal of induction of recA protein in E. coli. Mutat. Res. 131:53–59.[PubMed]

325. Sancar, A., G. B. Sancar, W. D. Rupp, J. W. Little, and D. W. Mount. 1982. LexA protein inhibits transcription of the E. coli uvrA gene in vitro. Nature (London) 298:96–98.[PubMed] [CrossRef]

326. Sancar, G. B., A. Sancar, J. W. Little, and W. D. Rupp. 1982. The uvrB gene of Escherichia coli has both lexA-repressed and lexA-independent promoters. Cell 28:523–530.[PubMed] [CrossRef]

327. Sancar, G. B., F. W. Smith, and A. Sancar. 1983. Identification and amplification of the E. coli phr gene product. Nucleic Acids Res. 11:6667–6678.[PubMed] [CrossRef]

328. Sandler, S. J., and A. J. Clark. 1994. RecOR suppression of recF mutant phenotypes in Escherichia coli K-12. J. Bacteriol. 176:3661–3672.[PubMed]

329. Sandler, S. J., H. S. Samra, and A. J. Clark. 1996. Differential suppression of priA2::kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC. Genetics 143:5–13.[PubMed]

330. Sargentini, N. J., and K. C. Smith. 1986. Quantitation of the involvement of the recA, recB, recC, recF, recJ, recN, lexA, radA, radB, uvrD, and umuC genes in the repair of X-ray-induced DNA double-strand breaks in Escherichia coli. Radiat. Res. 107:58–72.[PubMed] [CrossRef]

331. Sassanfar, M., and J. W. Roberts. 1990. Nature of the SOS-inducing signal in Escherichia coli: the involvement of DNA replication. J. Mol. Biol. 212:79–96.[PubMed] [CrossRef]

332. Sauer, R. T., M. J. Ross, and M. Ptashne. 1982. Cleavage of the λ and P22 repressors by RecA protein. J. Biol. Chem. 257:4458–4462.[PubMed]

333. Schlacher, K., K. Leslie, C. Wyman, R. Woodgate, M. M. Cox, and M. F. Goodman. 2005. DNA polymerase V and RecA protein, a minimal mutasome. Mol. Cell 17:561–572.[PubMed] [CrossRef]

334. Schnarr, M., M. Granger-Schnarr, S. Hurstel, and J. Pouyet. 1988. The carboxy-terminal domain of the LexA repressor oligomerises essentially as the entire protein. FEBS Lett. 234:56–60.[PubMed] [CrossRef]

335. Schnarr, M., P. Oertel-Buchheit, M. Kazmaier, and M. Granger-Schnarr. 1991. DNA binding properties of the LexA repressor. Biochimie 73:423–431.[PubMed] [CrossRef]

336. Schuldiner, S., V. Agmon, J. Brandsma, A. Cohen, E. Friedman, and E. Padan. 1986. Induction of SOS functions by alkaline intracellular pH in Escherichia coli. J. Bacteriol. 168:936–939.[PubMed]

337. Seong, I. S., J. Y. Oh, S. J. Yoo, J. H. Seol, and C. H. Chung. 1999. ATP-dependent degradation of SulA, a cell division inhibitor, by the HslVU protease in Escherichia coli. FEBS Lett. 456:211–214.[PubMed] [CrossRef]

338. Shan, Q., J. M. Bork, B. L. Webb, R. B. Inman, and M. M. Cox. 1997. RecA protein filaments: end-dependent dissociation from ssDNA and stabilization by RecO and RecR proteins. J. Mol. Biol. 265:519–540.[PubMed] [CrossRef]

339. Shen, X., J. M. Sayer, H. Kroth, I. Ponten, M. O'Donnell, R. Woodgate, D. M. Jerina, and M. F. Goodman. 2002. Efficiency and accuracy of SOS-induced DNA polymerases replicating benzo[a]pyrene-7,8-diol 9,10-epoxide A and G adducts. J. Biol. Chem. 277:5265–5274.[PubMed] [CrossRef]

340. Sherratt, D. J. 2003. Bacterial chromosome dynamics. Science 301:780–785.[PubMed] [CrossRef]

341. Shinagawa, H., H. Iwasaki, T. Kato, and A. Nakata. 1988. RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc. Natl. Acad. Sci. USA 85:1806–1810.[PubMed] [CrossRef]

342. Shinagawa, H., T. Kato, T. Ise, K. Makino, and A. Nakata. 1983. Cloning and characterization of the umu operon responsible for inducible mutagenesis in Escherichia coli. Gene 23:167–174.[PubMed] [CrossRef]

343. Shinagawa, H., K. Makino, M. Amemura, S. Kimura, H. Iwasaki, and A. Nakata. 1988. Structure and regulation of the Escherichia coli ruv operon involved in DNA repair and recombination. J. Bacteriol. 170:4322–4329.[PubMed]

344. Shurvinton, C. E., and R. G. Lloyd. 1982. Damage to DNA induces expression of the ruv gene of Escherichia coli. Mol. Gen. Genet. 185:352–355.[PubMed] [CrossRef]

345. Siegel, E. C. 1983. The Escherichia coli uvrD gene is inducible by DNA damage. Mol. Gen. Genet. 191:397–400.[PubMed] [CrossRef]

346. Sigal, N., H. Delius, T. Kornberg, M. L. Gefter, and B. Alberts. 1972. A DNA-unwinding protein isolated from Escherichia coli: its interaction with DNA and with DNA polymerases. Proc. Natl. Acad. Sci. USA 69:3537–3541.[PubMed] [CrossRef]

347. Silver, M. S., and A. R. Fersht. 1982. Direct observation of complexes formed between recA protein and a fluorescent single-stranded deoxyribonucleic acid derivative. Biochemistry 21:6066–6072.[PubMed] [CrossRef]

348. Simmons, L. A., A. D. Grossman, and G. C. Walker. 2007. Replication is required for the RecA localization response to DNA damage in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 104:1360–1365.[PubMed] [CrossRef]

349. Sims, J., and E. W. Benz, Jr. 1980. Initiation of DNA replication by the Escherichia coli dnaG protein: evidence that tertiary structure is involved. Proc. Natl. Acad. Sci. USA 77:900–904.[PubMed] [CrossRef]

350. Singleton, M. R., M. S. Dillingham, M. Gaudier, S. C. Kowalczykowski, and D. B. Wigley. 2004. Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature 432:187–193.[PubMed] [CrossRef]

351. Slater, S. C., M. R. Lifsics, M. O'Donnell, and R. Maurer. 1994. holE, the gene coding for the theta subunit of DNA polymerase III of Escherichia coli: characterization of a holE mutant and comparison with a dnaQ (epsilon-subunit) mutant. J. Bacteriol. 176:815–821.[PubMed]

352. Smith, M., M. M. Cavenaugh, and J. W. Little. 1991. Mutant LexA proteins with an increased rate of in vivo cleavage. Proc. Natl. Acad. Sci. USA 88:7356–7360.[PubMed] [CrossRef]

353. Snyder, M., and K. Drlica. 1979. DNA gyrase on the bacterial chromosome: DNA cleavage induced by oxolinic acid. J. Mol. Biol. 131:287–302.[PubMed] [CrossRef]

354. Sommer, S., J. Knezevic, A. Bailone, and R. Devoret. 1993. Induction of only one SOS operon, umuDC, is required for SOS mutagenesis in E. coli. Mol. Gen. Genet. 239:137–144.[PubMed]

355. Sousa, F. J., L. M. Lima, A. B. Pacheco, C. L. Oliveira, I. Torriani, D. F. Almeida, D. Foguel, J. L. Silva, and R. Mohana-Borges. 2006. Tetramerization of the LexA repressor in solution: implications for gene regulation of the E.coli SOS system at acidic pH. J. Mol. Biol. 359:1059–1074.[PubMed] [CrossRef]

356. Steinborn, G. 1978. Uvm mutants of Escherichia coli K12 deficient in UV mutagenesis. I. Isolation of uvm mutants and their phenotypical characterization in DNA repair and mutagenesis. Mol. Gen. Genet. 165:87–93.[PubMed] [CrossRef]

357. Stohl, E. A., J. P. Brockman, K. L. Burkle, K. Morimatsu, S. C. Kowalczykowski, and H. S. Seifert. 2003. Escherichia coli RecX inhibits RecA recombinase and coprotease activities in vitro and in vivo. J. Biol. Chem. 278:2278–2285.[PubMed] [CrossRef]

358. Story, R. M., D. K. Bishop, N. Kleckner, and T. A. Steitz. 1993. Structural relationship of bacterial RecA proteins to recombination proteins from bacteriophage T4 and yeast. Science 259:1892–1896.[PubMed] [CrossRef]

359. Story, R. M., and T. A. Steitz. 1992. Structure of the RecA protein-ADP complex. Nature (London) 355:374–376.[PubMed] [CrossRef]

360. Story, R. M., I. T. Weber, and T. A. Steitz. 1992. The structure of the E. coli recA protein monomer and polymer. Nature (London) 355:318–325.[PubMed] [CrossRef]

361. Sugino, A., C. L. Peebles, K. N. Kreuzer, and N. R. Cozzarelli. 1977. Mechanism of action of nalidixic acid: purification of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel nicking-closing enzyme. Proc. Natl. Acad. Sci. USA 74:4767–4771.[PubMed] [CrossRef]

362. Sukchawalit, R., P. Vattanaviboon, S. Utamapongchai, G. Vaughn, and S. Mongkolsuk. 2001. Characterization of Xanthomonas oryzae pv. oryzae recX, a gene that is required for high-level expression of recA. FEMS Microbiol. Lett. 205:83–89.[PubMed] [CrossRef]

363. Sutton, M. D. 2004. The Escherichia coli dnaN159 mutant displays altered DNA polymerase usage and chronic SOS induction. J. Bacteriol. 186:6738–6748.[PubMed] [CrossRef]

364. Sutton, M. D., M. F. Farrow, B. M. Burton, and G. C. Walker. 2001. Genetic interactions between the Escherichia coli umuDC gene products and the beta processivity clamp of the replicative DNA polymerase. J. Bacteriol. 183:2897–2909.[PubMed] [CrossRef]

365. Sutton, M. D., A. Guzzo, I. Narumi, M. Costanzo, C. Altenbach, A. E. Ferentz, W. L. Hubbell, and G. C. Walker. 2002. A model for the structure of the Escherichia coli SOS-regulated UmuD₂ protein. DNA Repair (Amst.) 1:77–93.[PubMed] [CrossRef]

366. Sutton, M. D., T. Opperman, and G. C. Walker. 1999. The Escherichia coli SOS mutagenesis proteins UmuD and UmuD' interact physically with the replicative DNA polymerase. Proc. Natl. Acad. Sci. USA 96:12373–12378.[PubMed] [CrossRef]

367. Sutton, M. D., B. T. Smith, V. G. Godoy, and G. C. Walker. 2000. The SOS response: recent insights into umuDC-dependent DNA damage tolerance. Annu. Rev. Genet. 34:479–497.[PubMed] [CrossRef]

368. Sweasy, J. B., M. Chen, and L. A. Loeb. 1995. DNA polymerase beta can substitute for DNA polymerase I in the initiation of plasmid DNA replication. J. Bacteriol. 177:2923–2925.[PubMed]

369. Trusca, D., S. Scott, C. Thompsopn, and D. Bramhill. 1998. Bacterial SOS checkpoint protein SulA inhibits polymerization of purified FtsZ cell division protein. J. Bacteriol. 180:3946–3953.[PubMed]

370. Tsaneva, I. R., G. Illing, R. G. Lloyd, and S. C. West. 1992. Purification and properties of the RuvA and RuvB proteins of Escherichia coli. Mol. Gen. Genet. 235:1-10. [CrossRef]

371. Tsaneva, I. R., B. Muller, and S. C. West. 1992. ATP-dependent branch migration of Holliday junctions promoted by the RuvA and RuvB proteins of E. coli. Cell 69:1171–1180.[PubMed] [CrossRef]

372. Tseng, Y. C., J. L. Hung, and T. C. Wang. 1994. Involvement of RecF pathway recombination genes in postreplication repair in UV-irradiated Escherichia coli cells. Mutat. Res. 315:1–9.[PubMed] [CrossRef]

373. Ubeda, C., P. Barry, J. R. Penades, and R. P. Novick. 2007. A pathogenicity island replicon in Staphylococcus aureus replicates as an unstable plasmid. Proc. Natl. Acad. Sci. USA 104:14182–14188.[PubMed] [CrossRef]

374. Ubeda, C., E. Maiques, E. Knecht, I. Lasa, R. P. Novick, and J. R. Penades. 2005. Antibiotic-induced SOS response promotes horizontal dissemination of pathogenicity island-encoded virulence factors in staphylococci. Mol. Microbiol. 56:836–844.[PubMed] [CrossRef]

375. Ubeda, C., E. Maiques, M. A. Tormo, S. Campoy, I. Lasa, J. Barbe, R. P. Novick, and J. R. Penades. 2007. SaPI operon I is required for SaPI packaging and is controlled by LexA. Mol. Microbiol. 65:41–50.[PubMed] [CrossRef]

376. Umezu, K., N.-W. Chi, and R. D. Kolodner. 1993. Biochemical interactions of the Escherichia coli RecF, RecO, and RecR proteins with RecA protein and single-stranded binding protein. Proc. Natl. Acad. Sci. USA 90:3875–3879.[PubMed] [CrossRef]

377. Umezu, K., and R. D. Kolodner. 1994. Protein interactions in genetic recombination in Escherichia coli. Interactions involving RecO and RecR overcome the inhibition of RecA by single-stranded DNA-binding protein. J. Biol. Chem. 269:30005–30013.[PubMed]

378. Umezu, K., K. Nakayama, and H. Nakayama. 1990. Escherichia coli RecQ protein is a DNA helicase. Proc. Natl. Acad. Sci. USA 87:5363–5367.[PubMed] [CrossRef]

379. VanLoock, M. S., X. Yu, S. Yang, V. E. Galkin, H. Huang, S. S. Rajan, W. F. Anderson, E. A. Stohl, H. S. Seifert, and E. H. Egelman. 2003. Complexes of RecA with LexA and RecX differentiate between active and inactive RecA nucleoprotein filaments. J. Mol. Biol. 333:345–354.[PubMed] [CrossRef]

380. VanLoock, M. S., X. Yu, S. Yang, A. L. Lai, C. Low, M. J. Campbell, and E. H. Egelman. 2003. ATP-mediated conformational changes in the RecA filament. Structure (Camb.) 11:187–196.[PubMed] [CrossRef]

381. Vierling, S., T. Weber, W. Wohlleben, and G. Muth. 2000. Transcriptional and mutational analyses of the Streptomyces lividans recX gene and its interference with RecA activity. J. Bacteriol. 182:4005–4011.[PubMed] [CrossRef]

382. Villani, G., A. Pierre, and B. Salles. 1984. Quantification of SSB protein in E. coli and its variation during RecA protein induction. Biochimie 66:471–476.[PubMed] [CrossRef]

383. Villaverde, A., and J. Barbe. 1992. SOS system induction in Escherichia coli cells with distinct levels of ribonucleotide reductase activity. Mutat. Res. 281:137–141.[PubMed] [CrossRef]

384. Vogel, J., L. Argaman, E. G. Wagner, and S. Altuvia. 2004. The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide. Curr. Biol. 14:2271–2276.[PubMed] [CrossRef]

385. Voloshin, O. N., and R. D. Camerini-Otero. 2007. The DinG protein from Escherichia coli is a structure-specific helicase. J. Biol. Chem. 282:18437–18447.[PubMed] [CrossRef]

386. Voloshin, O. N., B. E. Ramirez, A. Bax, and R. D. Camerini-Otero. 2001. A model for the abrogation of the SOS response by an SOS protein: a negatively charged helix in DinI mimics DNA in its interaction with RecA. Genes Dev. 15:415–427.[PubMed] [CrossRef]

387. Voloshin, O. N., F. Vanevski, P. P. Khil, and R. D. Camerini-Otero. 2003. Characterization of the DNA damage-inducible helicase DinG from Escherichia coli. J. Biol. Chem. 278:28284–28293.[PubMed] [CrossRef]

388. Wade, J. T., N. B. Reppas, G. M. Church, and K. Struhl. 2005. Genomic analysis of LexA binding reveals the permissive nature of the Escherichia coli genome and identifies unconventional target sites. Genes Dev. 19:2619–2630.[PubMed] [CrossRef]

389. Wagner, J., and T. Nohmi. 2000. Escherichia coli DNA polymerase IV mutator activity: genetic requirements and mutational specificity. J. Bacteriol. 182:4587–4595.[PubMed] [CrossRef]

390. Walker, G. C. 1985. Inducible DNA repair systems. Annu. Rev. Biochem. 54:425–457.[PubMed] [CrossRef]

391. Walker, G. C. 1984. Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli. Microbiol. Rev. 48:60–93.[PubMed]

392. Walker, G. C. 1987. The SOS response of Escherichia coli, p. 1346–1357. In F. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium, Cellular and Molecular Biology. American Society for Microbiology, Washington, DC.

393. Walker, G. C. 2001. To cleave or not to cleave? Insights from the LexA crystal structure. Mol. Cell 8:486–487.[PubMed] [CrossRef]

394. Wang, L., and J. Lutkenhaus. 1998. FtsK is an essential cell division protein that is localized to the septum and induced as part of the SOS response. Mol. Microbiol. 29:731–740.[PubMed] [CrossRef]

395. Wang, T.-C. V., and K. C. Smith. 1986. Postreplicational formation and repair of DNA double-strand breaks in UV-irradiated Escherichia coli uvrB cells. Mutat. Res. 165:39–44.[PubMed]

396. Wang, T. C., and K. C. Smith. 1988. Different effects of recJ and recN mutations on the postreplication repair of UV-damaged DNA in Escherichia coli K-12. J. Bacteriol. 170:2555–2559.[PubMed]

397. Wang, X., H. W. Cheung, A. C. Chun, D. Y. Jin, and Y. C. Wong. 2008. Mitotic checkpoint defects in human cancers and their implications to chemotherapy. Front. Biosci. 13:2103–2114.[PubMed] [CrossRef]

398. Wang, Z., E. Lazarov, M. O'Donnell, and M. F. Goodman. 2002. Resolving a fidelity paradox: why Escherichia coli DNA polymerase II makes more base substitution errors in AT- compared with GC-rich DNA. J. Biol. Chem. 277:4446–4454.[PubMed] [CrossRef]

399. Wechsler, J. A., and J. D. Gross. 1971. Escherichia coli mutants temperature-sensitive for DNA synthesis. Mol. Gen. Genet. 113:273–284.[PubMed] [CrossRef]

400. Weigle, J. J. 1953. Induction of mutation in a bacterial virus. Proc. Natl. Acad. Sci. USA 39:628–636.[PubMed] [CrossRef]

401. Weiss, D. S. 2004. Bacterial cell division and the septal ring. Mol. Microbiol. 54:588–597.[PubMed] [CrossRef]

402. Wertman, K. F., J. W. Little, and D. W. Mount. 1984. Rapid mutational analysis of regulatory loci in Escherichia coli K-12 using bacteriophage M13. Proc. Natl. Acad. Sci. USA 81:3801–3805.[PubMed] [CrossRef]

403. Wertman, K. F., and D. W. Mount. 1985. Nucleotide sequence binding specificity of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 163:376–384.[PubMed]

404. Whitby, M. C., and R. G. Lloyd. 1995. Altered SOS induction associated with mutations in recF, recO and recR. Mol. Gen. Genet. 246:174-179. [CrossRef]

405. Witkin, E. M. 1969. The mutability towards ultraviolet light of recombination-deficient strains of Escherichia coli. Mutat. Res. 8:9–14.[PubMed]

406. Witkin, E. M. 1967. Mutation-proof and mutation-prone modes of survival in derivatives of Escherichia coli B differing in sensitivity to ultraviolet light. Brookhaven Symp. Biol. 20:495–503.

407. Witkin, E. M. 1974. Thermal enhancement of ultraviolet mutability in a tif-1 uvrA derivative of Escherichia coli B/r: evidence that ultraviolet mutagenesis depends upon an inducible function. Proc. Natl. Acad. Sci. USA 71:1930–1934.[PubMed] [CrossRef]

408. Witkin, E. M. 1976. Ultraviolet mutagenesis and inducible DNA repair in Escherichia coli. Bacteriol. Rev. 40:869–907.[PubMed]

409. Witkin, E. M., J. O. McCall, M. R. Volkert, and I. E. Wermundsen. 1982. Constitutive expression of SOS functions and modulation of mutagenesis resulting from resolution of genetic instability at or near the recA locus of Escherichia coli. Mol. Gen. Genet. 185:43–50.[PubMed] [CrossRef]

410. Wood, L. F., N. Y. Tszine, and G. E. Christie. 1997. Activation of P2 late transcription by P2 Ogr protein requires a discrete contact site on the C terminus of the alpha subunit of Escherichia coli RNA polymerase. J. Mol. Biol. 274:1–7.[PubMed] [CrossRef]

411. Woodgate, R., and D. G. Ennis. 1991. Levels of chromosomally encoded Umu proteins and requirements for in vivo UmuD cleavage. Mol. Gen. Genet. 229:10–16.[PubMed]

412. Wuytack, E. Y., A. M. Diels, and C. W. Michiels. 2002. Bacterial inactivation by high-pressure homogenisation and high hydrostatic pressure. Int. J. Food Microbiol. 77:205–212.[PubMed] [CrossRef]

413. Yasuda, T., K. Morimatsu, T. Horii, T. Nagata, and H. Ohmori. 1998. Inhibition of Escherichia coli RecA coprotease activities by DinI. EMBO J. 17:3207–3216.[PubMed] [CrossRef]

414. Yasuda, T., K. Morimatsu, R. Kato, J. Usukura, M. Takahashi, and H. Ohmori. 2001. Physical interactions between DinI and RecA nucleoprotein filament for the regulation of SOS mutagenesis. EMBO J. 20:1192–1202.[PubMed] [CrossRef]

415. Yasuda, T., T. Nagata, and H. Ohmori. 1996. Multicopy suppressors of the cold-sensitive phenotype of the pcsA68 (dinD68) mutation in Echerichia coli. J. Bacteriol. 178:3854–3859.[PubMed]

416. Yoo, S. J., J. H. Seol, M. S. Kang, and C. H. Chung. 1996. Poly-l-lysine activates both peptide and ATP hydrolysis by the ATP-dependent HslVU protease in Escherichia coli. Biochem. Biophys. Res. Commun. 229:531–535.[PubMed] [CrossRef]

417. Yoo, S. J., J. H. Seol, D. H. Shin, M. Rohrwild, M. S. Kang, K. Tanaka, A. L. Goldberg, and C. H. Chung. 1996. Purification and characterization of the heat shock proteins HslV and HslU that form a new ATP-dependent protease in Escherichia coli. J. Biol. Chem. 271:14035–14040.[PubMed] [CrossRef]

418. Yu, X., and E. H. Egelman. 1993. The LexA repressor binds within the deep helical groove of the activated RecA filament. J. Mol. Biol. 231:29–40.[PubMed] [CrossRef]

419. Zlotnick, A., R. S. Mitchell, R. K. Steed, and S. L. Brenner. 1993. Analysis of two distinct single-stranded DNA binding sites on the recA nucleoprotein filament. J. Biol. Chem. 268:22525–22530.[PubMed]